Golden Promise Line TNP-22 Click here for a printable version of this frame.
DsT-22 Insertion Site Click here To order seeds for this line

Description: Golden Promise barley with a single copy of the Ds-Bar cassette transposed into the distal region of the short arm of chromosome 6H. This region contains a cluster of 4 distinct Ds inserts, DsT-18, DsT-22, DsT-28 and DsT-32B.

Summary    Primers    Sequences    Methods    Data    Links

Insertion Site Summary
Chromosome Bin
WSU Steptoe x Morex Bin Map
6H - Bin 13
Mapping  Strategy
See: Cooper L.D. et.al (2004) Mapping Ds insertions in barley using a sequence based approach. Mol. Genet. Genomics. Pubmed Link
Morex Barley BAC Library (Clemson University)
Hybridization Information

Morex Barley BAC Contig Database
Positive BAC clones (from filters F, G, N, Q)
Strong:  278L06,307F04, 661J14
Weak:  625D13, 625G14, 661L06

8bp duplication at insertion site
CTGAAGAG
DsT Terminal Inverted Repeat (TIR)
5' end intact:   TAGGGATGAAA         
3' end intact :  TTTCATCCCTG


Zea mays Transposase: Accession No. XO1380

Get FASTA file of the Ds-bar sequence

Get FASTA file of merged 5' and 3' sequences from Golden Promise (GP TNP-22)


Primers
TNP Primer
 Sequence
Position in Golden Promise Contig
TNP-22-5F CCGGTCCATGGTGTTGGCAAG
5
TNP-22-385R
TGTTGATGAGACCAGCCAAT
385

Ds Primer

Sequence

Position in Ds-Bar cassette

Ds5-142F
GATCCGGTCGGGTTAAAGTC
142
Ds5-379R
TGCACTGCAGGAATTCGATA
379
Nos3
CAATCCTGTTGCCGGTCTTG 2996
Ds3-N
TGAAACGGTCGGGAAACTAG
3319

Mapped Sequences
Sequence Name
GenBank Accession
OWB-D
AY505378
OWB-R
AY505379
Golden Promise, tagged region
AY505380

Methods
PCR Reaction

Diagnosis of  5' and 3' Ds Ends and Ds Cassette Movement

PCR is performed using either a 5' or 3' specific primer combined with a genomic specific primer to confirm the site of insertion for each line.  Expected sizes are given for each reaction.  Occasionally we will see an additional band or bands, depending on the reaction conditions and reagents used.  We have included these bands when they appear for reference purposes, but do not explain them based on the sequence.  It is possible that secondary genomic sites exist producing an alternate product.  In addition, the presence of gene families or tandem copies of genes may complicate the reactions. 

Primers specific to the Ds and to genomic sequence in PCR reactions are also used to evaluate movement of the cassette.   A hemizygous transposition will produce both the native amplification product, between the genomic primers in the non-transgenic Golden Promise line, as well as the TNP line's diagnostic product from the Ds end into the genomic sequence.  In some cases, the native amplification product is produced in the TNP lines as well.  We believe such cases to contain additional copies of the gene or sequence identical to the sequence surrounding the Ds insertion.    All TNP lines have been progeny tested and are homozygous.

PCR to diagnose 5’and 3'  Ds ends are used since the Ac Transposase lines contain the same selectable marker as the Ds transposable cassette (Bar).  Negative selection for AcTransposase using PCR must be used after crosses are made to the Ac containing line to confirm the absence of the transposase in order to maintain a stable line.  The abbreviated Ac Transposase is present without the Ds ends to disable autonomous movement of the transposase gene. 

Terminal Inverted Repeat

The Ds transposable element containing intact Terminal Inverted Repeats (TIR) is reported to transpose more efficiently than with imperfect repeats (Xiao, Y.-L., Peterson, T., MGG, 2002 266:720-731, Chatterjee, S., Starlinger P.  MGG 1995, 249:281-288).  We observed that the sequence of the TIR is occasionally mutated through transposition producing imperfect repeats with potentially low transposition efficiencies  (Singh, J., unpublished).

Data
PCR diagnostic
PCR gel coming soon

Links for this locus:

GrainGenes 2.0