Amplification of subcloned Langdon amplicons

 

Check LB plates after overnight incubation at 37 °C. Wait until you could clearly distinguish the white clones from the light blue clones. Transfer 12 white clones from the LB plate directly into the PCR mix using sterile pipet tips or toothpicks and perform PCR.

 

PCR mix with M13 -48 and T7 Universal  primers.

 

M13 -48 primer sequence: 5’- agcggataacaatttcacacagga - 3’

T7 Universal  primer sequence: 5’- taatacgactcactataggg - 3’

 

1 x reaction

 

5 ul       10x Taq polymerase buffer

5 ul       2mM dNTPs

1 ul       M13 -48 (50 pmole)

1 ul       T7 Universal (50 pmole)

0.2 ul    Taq polymerase

38 ul     water

Total: 50 ul

 

13 x reaction

 

65 ul     10x Taq polymerase buffer

65 ul     2mM dNTPs

13 ul     M13 -48 (50 pmole)

13 ul     T7 Universal (50 pmole)

2.6 ul    Taq polymerase

494 ul   water

 

 

PCR condition:

 

94°C – 10 min

 

10 cycles of:

 

94°C – 20 sec

58°C – 20 sec

72°C – 2 min

 

35 cycles of:

 

94°C – 20 sec

55°C – 20 sec

72°C – 2 min

 

72°C – 5 min

 

Check PCR products on 1 % agarose gel.

 

Treatment with Exonuclease I (USB cat#: 70073Z or 70073X) and Shrimp Alkaline Phophotase (USB cat#: 70092Y, 70092Z, 70092X) to remove excess of dNTPs and primers before sequencing.

 

Note: Only strong single band PCR products could be purified for sequencing using this approach.

 

5 ul       PCR product

2 ul       SAP (2 units)

1 ul       ExoI (10 units)

 

Incubate at 37C for 15 min, and then inactivate enzymes at 80C for 15 min.

Freeze and store at –20 C or –70C until needed.