Check LB plates after overnight incubation at 37 °C. Wait
until you could clearly distinguish the white clones from the light blue
clones. Transfer 12 white clones from the LB plate directly into the PCR mix using
sterile pipet tips or toothpicks and perform PCR.
PCR mix with M13 -48 and T7 Universal primers.
M13 -48 primer sequence: 5’- agcggataacaatttcacacagga - 3’
T7 Universal primer
sequence: 5’- taatacgactcactataggg - 3’
1 x reaction
5 ul 10x Taq polymerase
buffer
5 ul 2mM dNTPs
1 ul M13 -48 (50
pmole)
1 ul T7 Universal
(50 pmole)
0.2 ul Taq
polymerase
38 ul water
Total: 50 ul
13 x reaction
65 ul 10x Taq
polymerase buffer
65 ul 2mM dNTPs
13 ul M13 -48 (50
pmole)
13 ul T7 Universal
(50 pmole)
2.6 ul Taq
polymerase
494 ul water
PCR condition:
94°C – 10 min
10 cycles of:
94°C – 20 sec
58°C – 20 sec
72°C – 2 min
35 cycles of:
94°C – 20 sec
55°C – 20 sec
72°C – 2 min
72°C – 5 min
Check PCR products on 1 % agarose gel.
Treatment with Exonuclease I (USB cat#: 70073Z or 70073X)
and Shrimp Alkaline Phophotase (USB cat#: 70092Y, 70092Z, 70092X) to remove
excess of dNTPs and primers before sequencing.
Note: Only strong single band PCR products could be purified
for sequencing using this approach.
5 ul PCR product
2 ul SAP (2
units)
1 ul ExoI (10
units)
Incubate at 37C for 15 min, and then inactivate enzymes at
80C for 15 min.
Freeze and store at –20 C or –70C until needed.