Golden Promise Line TNP-31
| Click here for a printable version of this frame. | |
DsT-31 Insertion Site
| Click here To order seeds for this line | |
Summary
Primers
Sequences
Methods
Data
Links
| Chromosome Bin WSU Steptoe x Morex Bin Map |
7H - Bin 3 |
| Mapping Strategy |
See: Cooper L.D. et.al (2004) Mapping Ds insertions in barley using a sequence based approach. Mol. Genet. Genomics. Pubmed Link |
| Morex Barley BAC Library (Clemson University)
Hybridization Information Morex Barley BAC Contig Database |
Positive BAC clones (from filters A, O, F, Q) Strong: 284I24, 697A03, 695G17 |
| 8bp duplication at insertion site |
ACGGCAAT |
| DsT Terminal Inverted Repeat (TIR) |
5' end Intact: TAGGGATGAAA 3' end Intact: TTTCATCCCTG |
Zea mays Transposase: Accession No. XO1380
Get FASTA file of the Ds-bar sequence
Get FASTA file of
merged 5' and 3'
sequences from Golden Promise (GP TNP-31)
| TNP Primer |
Sequence |
Position in Golden Promise Contig |
| TNP-31-133F |
GGACATCGCATCGCCTACAC |
133 |
| TNP-31-748R |
CACACCCTTTCAACCCCCAAG |
746 |
Ds Primer |
Sequence |
Position in Ds-Bar cassette |
| Ds5-142F |
GATCCGGTCGGGTTAAAGTC |
142 |
| Ds5-379R |
TGCACTGCAGGAATTCGATA |
379 |
| Nos3 |
CAATCCTGTTGCCGGTCTTG | 2996 |
| Ds3-N |
TGAAACGGTCGGGAAACTAG |
3319 |
Mapped
Sequences
Sequence Name
GenBank Accession
OWB-D
AY505395
OWB-R
AY505396
Golden Promise, tagged region
AY505397
Methods
PCR
Reaction
Diagnosis of 5' and 3' Ds Ends and Ds Cassette MovementPCR is performed using either a 5' or 3' specific primer combined with a genomic specific primer to confirm the site of insertion for each line. Expected sizes are given for each reaction. Occasionally we will see an additional band or bands, depending on the reaction conditions and reagents used. We have included these bands when they appear for reference purposes, but do not explain them based on the sequence. It is possible that secondary genomic sites exist producing an alternate product. In addition, the presence of gene families or tandem copies of genes may complicate the reactions.Primers specific to the Ds and to genomic sequence in PCR reactions are also used to evaluate movement of the cassette. A hemizygous transposition will produce both the native amplification product, between the genomic primers in the non-transgenic Golden Promise line, as well as the TNP line's diagnostic product from the Ds end into the genomic sequence. In some cases, the native amplification product is produced in the TNP lines as well. We believe such cases to contain additional copies of the gene or sequence identical to the sequence surrounding the Ds insertion. All TNP lines have been progeny tested and are homozygous. PCR to diagnose 5’and 3' Ds ends are used since the Ac Transposase lines contain the same selectable marker as the Ds transposable cassette (Bar). Negative selection for AcTransposase using PCR must be used after crosses are made to the Ac containing line to confirm the absence of the transposase in order to maintain a stable line. The abbreviated Ac Transposase is present without the Ds ends to disable autonomous movement of the transposase gene. Terminal Inverted RepeatThe Ds transposable element containing intact Terminal Inverted Repeats (TIR) is reported to transpose more efficiently than with imperfect repeats (Xiao, Y.-L., Peterson, T., MGG, 2002 266:720-731, Chatterjee, S., Starlinger P. MGG 1995, 249:281-288). We observed that the sequence of the TIR is occasionally mutated through transposition producing imperfect repeats with potentially low transposition efficiencies (Singh, J., unpublished). |