GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Marker Report: ABA001

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABA001
Type
RFLP
STS
Synonym
SynonymABA001
 ABA1
Chromosome
3H
5H
Map
Hordeum-AxK-3H57
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Probe
ABA001
ABA1
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex



Probe for Locus
ABA1
Locus
ABA1
ABA001
Type
cDNA
PCR
STS
PCR primers
CACGCCCTCGCCAACGCTCTCCA
GGGGAGATATCGACCAAAGT
Source Species
Hordeum vulgare
Clone Authority
Kleinhofs, Andris
Blake, Tom
Data Source
Kleinhofs, Andris92.09
Blake, Tom95.08.24



Probe
ABA001
Locus
ABA001

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.