GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Marker Report: ABC160

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC160
Type
RFLP
STS
Synonym
SynonymABC160
Chromosome
1H
Chromosome Arm
1HL
Map
Barley-Consensus-1H39.2
[ Show all 22 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QBgn.StMo-1H
[ Show all 6 ]
Map Data
Barley consensus
[ Show all 22 ]
Species
Hordeum vulgare
Probe
ABC160
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of ABC160 in the Barley, Consensus 2006 DArT maps = 2
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec
Possible Orthologs
abc160.1
abc160.2
Xabc160
Xabc160-1



Probe
ABC160
Locus
ABC160
[ Show all 11 ]
Synonym
SynonymHAR35_23388
External Databases
DDBJ
EMBL
GenBank
Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
GCCAGCGCTCCGGTCTGGTC
AACAAGGCCGCATGGATGTA
Sequence
L43929
ABC160
ABC160-5
Linkage Group
Group 5
Source Species
Hordeum vulgare
Insert Size
0.3
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24
ATMI92.09



Locus for Probe
D1.1_ctg214
Type
BAC_contig
Map
Chinese_Spring_Deletion_1D0.705
Chinese_Spring_Deletion_7D0.715
Ta-Physical-Gill-1D1.56
[ Show Nearby Loci ]
Probe
ABC160
BF475035



Locus for Probe
HI001O16
Probe
ABC160



Locus for Probe
HI002A15
Probe
ABC160



Locus for Probe
ABC160-1H
Map
Hv-DxR-Stein-1H75.77
Hv-SxM-Stein-1H63.71
[ Show Nearby Loci ]
Map Data
Barley, OWB, Stein2006
Barley, SxM, Stein2006
Probe
ABC160



Locus for Probe
abc160.1
Type
RFLP
Chromosome
1H
Chromosome Arm
1HS
Map Data
Barley, Wise
Probe
ABC160
Possible Orthologs
ABC160
abc160.2
Xabc160
Xabc160-1



Locus for Probe
abc160.2
Type
RFLP
Chromosome
1H
Chromosome Arm
1HS
Map Data
Barley, Wise
Probe
ABC160
Possible Orthologs
ABC160
abc160.1
Xabc160
Xabc160-1



Locus for Probe
RI002E10
Probe
ABC160



Locus for Probe
Xabc160
Type
RFLP
Chromosome
1A
1R
Chromosome Arm
1AL
1RS
Map
Secale-UxE-132.3
Ta-Physical-Gill-1D1.56
Tm-Dubcovsky2-1A10
TmTa-Dubcovsky-1A10.6
[ Show Nearby Loci ]
Breakpoint Interval
1DL-6/1DL-8
Map Data
Rye, UC90 x E-line
T. monococcum, DV92 x G3116
Triticum, CS-G1777 DS1A^m^(1A) RSL
Wheat, Physical
Probe
ABC160
Possible Orthologs
ABC160
abc160.1
abc160.2
Xabc160-1



Locus for Probe
Xabc160-1
Type
RFLP
Chromosome Arm
1L
Map
Triticeae-Sorrells-161
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
ABC160
Possible Orthologs
ABC160
abc160.1
abc160.2
Xabc160



Locus for Probe
Xabc160u
Type
RFLP
Chromosome
3R
Chromosome Arm
3RL
Map
Secale-UxE-3103.4
[ Show Nearby Loci ]
Map Data
Rye, UC90 x E-line
Probe
ABC160

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.