| |
| |
| |
| |
| |
| |
| |
| |
| |
|  | Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. |
|  | Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. |
|  | Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. |
|  | Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027. |
|
|
| |
| | Number of populations contributing to the placement of ABG500B in the Barley, Consensus 2006 DArT maps = 1 | | Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' | | Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka | | Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka |
|
| |
| |
| |
| |
| |
| |
| |
| GCTAGAACTTGACCAATCTC AAGAAGAACCCGGAGAATCT |
|
| 5' ATTAATCCGACCGTCACTGC 5' ACGAACTCCTCGCTGCC |
|
| |
| | STS annealing temperature 58-60 oC |
|
| |
| |
| |
| |
| |