GrainGenes Marker Report: Bmac213

[ Printable Version ]  [ Submit comment/correction ]

Locus	Bmac213
Type	Microsatellite
Synonym	Synonym Bmac0213
Chromosome	1H
Map	Barley-consensus-2003-1H 52.3 Hordeum-Consensus2006-DArT-1H 25.1 Hordeum-IxF-SSR-1H 18.6 Hordeum-SxM-SSR-1H 19.4 Hordeum-Zhedar2-FHB-QTL-1H 22.4
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT Barley, Igri x Franka, SSR Barley, Steptoe x Morex, SSR Barley, Zhedar2, FHB QTL
Probe	Bmac213
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of Bmac213 in the Barley, Consensus 2006 DArT maps = 1
Probe	Bmac213
Locus	Bmac0213 Bmac213
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)23 Quality = 2: Single product, relatively strong stutter bands
Type	PCR SSR
PCR primers	5' ATGGATGCAAGACCAAAC 3' 5' CTATGAGAGGTAGAGCAGCC 3' ATGGATGCAAGACCAAAC CTATGAGAGGTAGAGCAGCC
SSR size	168
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare
Locus for Probe	Bmac0213
Type	Microsatellite
Synonym	Synonym Bmac213
Chromosome	1H
Map	Barley, B73xCPI-1H 21.3 [ Show all 12 ]
	[ Show Nearby Loci ]
In QTL	QHea.pil-1H.2
Map Data	Barley, Abiotic QTL Consensus [ Show all 12 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0213 Bmac213
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]