| |
| |
| |
| |
| |
| |
| |
| |
| |
|  | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
|  | Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| | Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum | | Insert contains repeat (CT)7(ATCT)6 (CT)14 | | Developing laboratory = SCRI (R. Waugh) |
|
| |
| |
| |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| | Insert contains repeat (CT)7(ATCT)6(CT)14 | | Quality = 2: Single product, relatively strong stutter bands | | Null in H. spontaneum Canada Park. |
|
| |
| 5' TTTTATTATTGCATCTAGGGC 3' 5' TATCAAGATCATGACGTCTCA 3' |
|
| |
| | 1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C. |
|
| |
| |
| |
| |
|  | Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. |
|  | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| |
| TTTTATTATTGCATCTAGGGC TATCAAGATCATGACGTCTCA |
|