GrainGenes Marker Report: Bmag0482c

[ Printable Version ]  [ Submit comment/correction ]

Locus	Bmag0482c
Type	Microsatellite
Chromosome	3H
Map	Hordeum-Consensus2007-SSR-3H 52.82
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0482
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AG)17 Polymorphic Information Content (PIC) = 0.61 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	Bmag0482
Locus	Bmag0482a Bmag0482b Bmag0482c
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	TATATGTCGGGAGAGATCAAG ATAGTTTAGCCCTCCACTAGC