| |
| |
| |
| |
| |
| |
| |
| |
| |
|  | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
|  | Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| | Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' | | [ Show all 7 ] |
|
| |
| |
| |
|  | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| | Insert contains repeat (CA)6TA(CA)3(GA)2(CA)6TA(CA)17 | | Quality = 1: Single product, only weak stutter bands | | Diversity Index (DI) = 0.9 |
|
| |
| 5' GGTAAAACATTTCCCTCGT 3' 5' TAGAGATCACTCTCTTCTGTGC 3' | GGTAAAACATTTCCCTCGT TAGAGATCACTCTCTTCTGTGC |
|
| |
| | 1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C. |
|
| |