GrainGenes Marker Report: EBmac635

[ Printable Version ]  [ Submit comment/correction ]

Locus	EBmac635
Type	Microsatellite
Synonym	Synonym Ebmac0635
Chromosome	4H
Map	Barley-consensus-2003-4H 37.8 Hordeum-Consensus2006-DArT-4H 113.5
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT Barley, Steptoe x Morex, SSR
Probe	EBmac635
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of EBmac635 in the Barley, Consensus 2006 DArT maps = 2
Probe	EBmac635
Locus	Ebmac0635 EBmac635
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)23 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.54
Type	PCR SSR
PCR primers	5' TGCTGCGATGATGAGAACT 3' 5' TAGGGTAGATCCGTCCCTATG 3' TGCTGCGATGATGAGAACT TAGGGTAGATCCGTCCCTATG
SSR size	116
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare
Locus for Probe	Ebmac0635
Type	Microsatellite
Synonym	Synonym EBmac635
Chromosome	4H
Map	Barley, B73xCPI-4H 101 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 9 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Ebmac0635 EBmac635
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]