GrainGenes Marker Report: GBM1501-4H

[ Printable Version ]  [ Submit comment/correction ]

Locus	GBM1501-4H
Type	Microsatellite
Map	Hv-Consensus2006-Stein-4H 0 Hv-DxR-Stein-4H 0
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Stein Barley, OWB, Stein2006
Probe	GBM1501
Probe for Locus	GBM1501
Locus	GBM1501 GBM1501-4H
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
General Remarks	Clone HS08I08u
Type	SSR
PCR primers	Forward TGTGGACAGTCAAACACGCT Reverse AAGGAGCACCTGAAAAGCAA TGTGGACAGTCAAACACGCT AAGGAGCACCTGAAAAGCAA
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	CA000412
DNA Library	IPK-HS
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)
Data Source	Stein, Nils 2006.10