GrainGenes Marker Report: HVM002B-2

[ Printable Version ]  [ Submit comment/correction ]

Locus	HVM002B-2
Type	Microsatellite
Synonym	Other name HVM2b Synonym HVM2
Chromosome	7H
Map	Hordeum-Bins-7H 73.5 Hordeum-Consensus2005-SNP-7H 83.987 Hordeum-QTLConsensus-Abiotic-7H 83.99 Hordeum-QTLConsensus-Agronomic-7H 83.99 Hordeum-StMo-SNP-7H 70.67
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Steptoe x Morex, SNP
Probe	HVM2
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Probe for Locus	HVM2
Locus	HVM2a HVM2b HVM002B-1 HVM002B-2 HVM2
Reference	Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
General Remarks	Insert contains repeat (GA)11.
Type	PCR SSR
PCR primers	5' CAGGTGTCTAGTGGGTGCCT 3' 5' TTACATACCAAGGAGCAATCCC 3'
SSR size	0.201
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector	pGEM-7zf(+)
Vector Enzyme	ClaI
Data Source	Saghai Maroof, M.A. 97.01.02