GrainGenes Marker Report: MWG2040B

[ Printable Version ]  [ Submit comment/correction ]

Locus	MWG2040B
Type	RFLP
Synonym	Synonym MWG2040
Chromosome	5H
Map	Barley-Consensus2-5H 53.1 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 11 ]
Probe	MWG2040
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	MWG2040
Probe for Locus	MWG2040
Locus	MWG2040B [ Show all 8 ]
Type	Genomic STS
STS primers	5' GATGAGATGTGACTTCGACA 5' CTTCACAACATGCCTAAGAT
STS size	319
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234731 MWG2040-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Clone Vector	Bluescript
Excision Enzyme	PstI
Clone Location	Graner, Andreas
Clone Authority	Graner, Andreas
Data Source	Graner, Andreas 94.03.08 Kuenzel, Gottfried 00.03