GrainGenes Marker Report: SukEM59a

[ Printable Version ]  [ Submit comment/correction ]

Locus	SukEM59a
Type	SSAP
Chromosome	4H
Map	Hordeum-SxM-SSAP-4H 59.9
	[ Show Nearby Loci ]
Map Data	Barley, Steptoe x Morex, SSAP
Probe	SukEM59
Reference	Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
Probe for Locus	SukEM59
Locus	SukEM49j [ Show all 26 ]
Reference	Leigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
General Remarks	Position of retroposon-based primer in the LTR = 5' and 6 nucleotides internal to the LTR terminus MseI primer (KeyGene code) = CTA (M59)
Type	PCR STS
PCR primers	Sukkula-E0228 5' GGAACGTCGGCATCGGGCTG 3' Mse1 primer M59 5' GATGAGTCCTGAGTAACTA 3'
Amplification Conditions	amplified as Vos et al Nucl Acids Res 23: 4407-4418
Source Species	Hordeum vulgare