GrainGenes Marker Report: UMB308

[ Printable Version ]  [ Submit comment/correction ]

Locus	UMB308
Type	Microsatellite
Chromosome	3H
Species	Hordeum vulgare
Probe	UMB308
Reference	Beaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
Remark	Marker polymorphic in : Atahualpa x M81; Chevron x M69; Frederickson x Stander; Harrington x OUH602; Steptoe x Morex Marker mapped in : Frederickson x Stander; Steptoe x Morex Quality Score = 2.5 (1=Very easy to score and 5=Very hard to score) Number of alleles = 2
Probe	UMB308
Locus	UMB308
Reference	Beaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
Remarks	See reference for PCR and amplification conditions
Type	SSR
PCR primers	CCCCTCAGGTTGTTCATCAT AGCAGCAGCAACAACAACAG
Sequence	CB859861