GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Marker Report: WMC777

[ Printable Version ]  [ Submit comment/correction ]

Locus
wmc777
Map
Physical-3B56.4
[ Show Nearby Loci ]
Map Data
3B Physical



Probe
WMC777
Locus
Xwmc777-3B
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward GCCATCAAGCGGATCAACT
Reverse GTAGCGCCCTGTTTCACCTC
SSR size
142 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07



Locus for Probe
Xwmc777-3B
Type
Microsatellite
Chromosome
3B
Map
Louise/Penawawa-3B65.7
Ta-SSR-2004-3B57.7
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Louise x Penawawa
Probe
WMC777
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.