| |
| |
| |
| |
| |
| |
| |
| |
| |
| |
|  | Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. |
|  | Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. |
|
|
| |
| | In Map Ta-Synthetic/Opata-SSR-1B, the interval most likely to contain locus is between Xbcd1124 and Xcdo1173 |
|
| |
| |
| |
|  | Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. |
|  | Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333. |
|
|
| | Insert contains repeat (CA)17GA(TA)4 | | PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. | | Repeat type (CA)x17GA(TA)x4. | | Product size 186 bp in Chinese Spring. |
|
| |
| 5' TGGCGCCATGATTGCATTATCTTC 3' 5' GGTTGCTGAAGAACCTTATTTAGG 3' |
|
| | 3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C |
|
| |
| |
| |
| |