GrainGenes Marker Report: XksuD23.1

[ Printable Version ]  [ Submit comment/correction ]

Locus	XksuD23.1
Type	RFLP
Chromosome	2B
Map	Tm-Dubcovsky2-2A 75.4 Wheat-Composite2004-2B 109
	[ Show Nearby Loci ]
Map Data	T. monococcum, DV92 x G3116 Wheat, Composite, 2004
Probe	pTtksuD23
Probe for Locus	pTtksuD23
Locus	XksuD23-2 [ Show all 10 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AGGCAGTGAAGAAGAAGAACC L:TTGAAATCGACAGGATTAGGA
Polymorphism	KSUD23 XbaI   KSUD23 EcoRI   KSUD23 EcoRV   KSUD23 HindIII   KSUD23 DraI
Linkage Group	2DL
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.8
Clone Vector	pUC18
Excision Enzyme	PstI
Clone Location	GrainGenes Probe Repository Gill, Bikram S.
Image	KSUD23 SO autoradiogram
Data Source	Talbert, Luther E. 94.09.12 ATMI 92.09 Gill, Bikram S. 92.09