GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Marker Report: Xwmc728-1B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xwmc728-1B
Type
Microsatellite
Chromosome
1B
Map
Kofa/UC1113-1B144.4
Ta-SSR-2004-1B109.5
USG3209/Jaypee-1B200.6
[ Show Nearby Loci ]
Map Data
Durum wheat, Kofa x UC1113
Durum wheat, Svevo x Ciccio
Wheat, Consensus SSR, 2004
Wheat, USG3209 x Jaypee
Probe
WMC728
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.



Probe for Locus
WMC728
Locus
Xwmc728-1B
Xwmc728
Xwmc728-2A
Xwmc728-5B
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward GCAGGCTCTGCATCTTCTTG
Reverse CGCAGAGCTGAGCTGAAATC
SSR size
326 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.