GrainGenes Marker Report: cMWG654

[ Printable Version ]  [ Submit comment/correction ]

Locus	cMWG654
Type	RFLP
Synonym	Synonym POPA1_0385
Chromosome	5H
Map	Barley-Consensus2-5H 157.6 Hordeum-Bins-5H 168 Hordeum-Graner2-5H 176.2 Hv-Consensus2006-Marcel-5H 144.93 Hv-Integrated2009-5H 142.9
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	cMWG654
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	cMWG654
Locus	cMWG654 cMWG654-5H
Synonym	Synonym HAR35_10660   HAR35_15550   HAR35_15551
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' GTCCACGCCGTCCCCGATCT 5' CCGTCATCAAGGTTGGAGCA
STS size	ca. 500
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234406 CMWG654-5
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Clone Vector	Bluescript
Clone Location	GrainGenes Probe Repository Graner, Andreas
Clone Authority	Graner, Andreas
Data Source	Graner, Andreas 94.03.08 Stein, Nils 2006.10 Kuenzel, Gottfried 00.03
Locus for Probe	cMWG654-5H
Map	Hv-Consensus2006-Stein-5H 158.6 Hv-IxF-Stein-5H 126.64
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Stein Barley, IxF, Stein2006
Probe	cMWG654