| |
| |
| |
| |
| |
| |
| |
| |
| |
|  | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
|  | Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| | [ Hide all but 1 of 7 ] | | Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' | | Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex | | Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex | | Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Steptoe x Morex, Lina x H. spontaneum | | Insert contains repeat (AC)9AT(AC)7 (AG)9 | | Polymorphic Information Content (PIC) = 0.62 | | Developing laboratory = SCRI (R. Waugh) |
|
| |
| |
| |
|  | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| |
| GATTGGAGCTTCGGATCAC CCGTCTAGGGAGAGGTTCTC |
|
| |
| |
| |
|  | Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005. |
|
|
| | Insert contains repeat (AC)9AT(AC)7(AG)9 | | Quality = 1: Single product, only weak stutter bands | | Diversity Index (DI) = 0.62 |
|
| |
| 5' GATTGGAGCTTCGGATCAC 3' 5' CCGTCTAGGGAGAGGTTCTC 3' |
|
| |
| | 1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C. |
|
| |
| |
| |
| |
|  | Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. |
|
|
| |
| GATTGGAGCTTCGGATCAC CCGTCTAGGGAGAGGTTCTC |
|