GrainGenes Marker Report: MWG938

[ Printable Version ]  [ Submit comment/correction ]

Locus	MWG938
Type	RFLP
Synonym	Synonym MWG938
Chromosome	1H
Chromosome Arm	1HS
Map	[ Hide all but 1 of 20 ] Barley-Consensus-1H -34.7 Barley-Consensus2-1H 24.4 Hordeum-AxK-1H 5.7 Hordeum-Bins-1H 9.8 Hordeum-Consensus2005-SNP-1H 14.579 Hordeum-Consensus2006-DArT-1H 7.2 Hordeum-Consensus2007-SSR-1H 11.63 Hordeum-Graner2-1H 1.5 Hordeum-HxM-base-1H 0 Hordeum-IxF-SSR-1H 4.6 Hordeum-OPA-2009-1H 6.37 Hordeum-PilotOPA1-1H 9.261 Hordeum-QTLConsensus-Abiotic-1H 14.58 Hordeum-QTLConsensus-Agronomic-1H 14.58 Hordeum-StMo-SNP-1H 20.41 Hordeum-SxM-base-1H 3.4 Hordeum-SxM-SSAP-1H 2.3 Hordeum-SxM-SSR-1H 0 Hv-Consensus2006-Marcel-1H 11.63 Hv-Integrated2009-1H 13.8
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 22 ]
Species	Hordeum vulgare
Probe	MWG938
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 6 ]
Data Source	Close, Timothy J.
Remark	Inadvertently misnamed MWG983 in Barley Genetics Newsletter 23:53, 1993. [ Show all 6 ]
Possible Orthologs	Xmwg938 Xmwg938-1 Xmwg938-1B Xmwg938-1D Xmwg938-7A
Probe	MWG938
Locus	Xmwg938-1 [ Show all 9 ]
Reference	Sayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18.
Type	Genomic STS
STS primers	T7 side (5' to 3') ACGTAGTTGATGCAGAACCAATAGC T3 side (5' to 3') GTCGCCTCTCGTATCATTTCAAAAG
Sequence	BH854309 BH854310 MWG938 MWG938-5 MWG938-3
Polymorphism	MWG938 EcoRI
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Clone Vector	Bluescript
Excision Enzyme	PstI
Clone Location	Graner, Andreas
Clone Authority	Graner, Andreas
Image	MWG938 SO autoradiogram
Data Source	Graner, Andreas 94.03.08
Locus for Probe	MWG938-1H
Map	Hv-IxF-Stein-1H 13.32 Hv-SxM-Stein-1H 0
	[ Show Nearby Loci ]
Map Data	Barley, IxF, Stein2006 Barley, SxM, Stein2006
Probe	MWG938
Locus for Probe	Xmwg938
Type	RFLP
Chromosome	1R 7A
Chromosome Arm	1RS
Map	Avena-Sorrells-A -3 Secale-PxP-1 0 Secale-PxP-update-1R 2.1 Ta-Physical-Gill-1D -2.59 Wheat-Composite2004-7A 183
	[ Show Nearby Loci ]
Breakpoint Interval	0/1DS-5
Map Data	Diploid Oat, Cornell2 Rye, P87 x P105 Rye, P87 x P105, update Wheat, Composite, 2004 Wheat, Physical
Probe	MWG938
Possible Orthologs	MWG938 Xmwg938-1 Xmwg938-1B Xmwg938-1D Xmwg938-7A
Locus for Probe	Xmwg938-1
Type	RFLP
Chromosome Arm	1S
Map	Triticeae-Sorrells-1 6
	[ Show Nearby Loci ]
Map Data	Triticeae consensus
Probe	MWG938
Possible Orthologs	MWG938 Xmwg938 Xmwg938-1B Xmwg938-1D Xmwg938-7A
Locus for Probe	Xmwg938-1B
Type	RFLP
Chromosome	1B
Chromosome Arm	1BS
Map	[ Hide all but 1 of 6 ] Ta-Synthetic/Opata-1B 14.6 Ta-Synthetic/Opata-BARC-1B 13.9 Ta-Synthetic/Opata-DR-1B -22.2 Ta-Synthetic/Opata-GPW-1B 16.8 Ta-Synthetic/Opata-SSR-1B 14.5 Ta-Synthetic/Opata-SSR2-1B 14.4
	[ Show Nearby Loci ]
Map Data	Wheat, Synthetic x Opata  [ GBrowser ] [ Show all 6 ]
Probe	MWG938
Image	MWG938 SO autoradiogram
Possible Orthologs	MWG938 Xmwg938 Xmwg938-1 Xmwg938-1D Xmwg938-7A
Locus for Probe	Xmwg938-1D
Type	RFLP
Chromosome	1D
Chromosome Arm	1DS
Map	[ Hide all but 1 of 9 ] 1DS, Ae. tauschii 17.3 1DS-A.tauschii-AUSxCPI 5.2 Ta-Synthetic/Opata-1D 17.6 Ta-Synthetic/Opata-BARC-1D 12.5 Ta-Synthetic/Opata-DR-1D -32.1 Ta-Synthetic/Opata-gbx-1D 14.2 Ta-Synthetic/Opata-GPW-1D 22.1 Ta-Synthetic/Opata-SSR-1D 6.6 Ta-Synthetic/Opata-SSR_D-1D 7.9
	[ Show Nearby Loci ]
Map Data	1DS, A.tauschii, AUS x CPI [ Show all 9 ]
Species	Aegilops tauschii
Probe	MWG938
Image	MWG938 SO autoradiogram
Reference	Spielmeyer W et al. (2000) Highly recombinogenic regions at seed storage protein loci on chromosome IDS of Aegilops tauschii, the D- genome donor of wheat Genetics 155:361-367. Spielmeyer W et al. (2000) NBS-LRR sequence family is associated with leaf and stripe rust resistance on the end of homoeologous chromosome group 1S of wheat Theoretical and Applied Genetics 101:1139-1144.
Possible Orthologs	MWG938 Xmwg938 Xmwg938-1 Xmwg938-1B Xmwg938-7A
Locus for Probe	Xmwg938-7A
Type	RFLP
Chromosome	7A
Chromosome Arm	7AL
Map	Ta-Synthetic/Opata-7A 196.3 Ta-Synthetic/Opata-GPW-7A 208.7 Triticum-AxF-7A 197.8
	[ Show Nearby Loci ]
Map Data	Wheat, Arina x Forno Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, GPW
Species	Triticum aestivum
Probe	MWG938
Image	MWG938 SO autoradiogram
Reference	Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs	MWG938 Xmwg938 Xmwg938-1 Xmwg938-1B Xmwg938-1D
Locus for Probe	Xmwg938a
Type	RFLP
Chromosome	1B
Map	Wheat-Composite2004-1B 11
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004
Probe	MWG938
Locus for Probe	Xmwg938b
Type	RFLP
Chromosome	1B 1D
Map	Wheat-Composite2004-1B 66 Wheat-Composite2004-1D 6
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004
Probe	MWG938