GrainGenes Marker Report: XksuE18-1A

Locus	XksuE18-1A
Type	RFLP
Chromosome	1A
Chromosome Arm	1AS
Map	Ta-Courtot/CS-GPW-1A 18.7 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 9 ] T. monococcum, DV92 x G3116 Wheat, Arina x Forno Wheat, Courtot x Chinese Spring, GPW Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, gbx RFLP Wheat, Synthetic x Opata, GPW Wheat, Synthetic x Opata, SSR Wheat, Synthetic x Opata, SSR 2
Species	Triticum aestivum
Probe	pTtksuE18
Image	KSUE18 DraI SO autoradiogram KSUE18 HindIII SO autoradiogram
Reference	Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs	DGE18 [ Show all 8 ]
Probe for Locus	pTtksuE18
Locus	XksuE18-6B [ Show all 22 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:TGAGCCGGTTGCTGTTCGTC L:AAGCACCGACATGGTCACCC
Amplification Conditions	Anneal at 45oC
Polymorphism	KSUE18 DraI   KSUE18 HindIII
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Source Tissue	leaf
Insert Size	1.5
Clone Vector	pUC18
Excision Enzyme	PstI
Clone Location	GrainGenes Probe Repository Gill, Bikram S.
Image	KSUE18 DraI SO autoradiogram KSUE18 HindIII SO autoradiogram
Data Source	Talbert, Luther E. 95.07.06 ATMI 92.09 Gill, Bikram S. 92.09