GrainGenes Marker Report: 0501A

[ Printable Version ]  [ Submit comment/correction ]

Locus	0501A
Type	Microsatellite
Synonym	Synonym 0501A(dm501f.1/dm501r.1)
Chromosome	1H
Map	Barley, B73xCPI-1H 52.3 Hordeum-Consensus2006-DArT-1H 59.2
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2006, DArT
Probe	0501A
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of 0501A in the Barley, Consensus 2006 DArT maps = 1
Probe	0501A
Locus	0501A
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type	SSR
PCR primers	TAAGTGCCATGCAAAGGCTCAAA AGGGACAAAAATGGCTAAGC