GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Marker Report: E014a

[ Printable Version ]  [ Submit comment/correction ]

Locus
E014a
Type
RFLP
Map
Tt-Gill-3D420
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuE14
Possible Orthologs
E014b
[ Show all 6 ]



Probe for Locus
pTtksuE14
Locus
XksuE14-3
[ Show all 12 ]
Type
Genomic
STS
PCR primers
R:GCAGTTACAGGACCAACAGA
L:GAGACCCAGGAGTCCATCAG
Polymorphism
KSUE14 EcoRI 
KSUE14 EcoRV 
KSUE14 HindIII 
KSUE14 XbaI 
Linkage Group
6D (2)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE14 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.