GrainGenes Marker Report: Yr17/Lr37/Sr38

[ Printable Version ]  [ Submit comment/correction ]

Locus	Yr17/Lr37/Sr38
Type	Trait
Chromosome	2A
Chromosome Arm	2A
Map	Wheat-Composite2004-2A 0
	[ Show Nearby Loci ]
Species	Triticum aestivum
Probe	cMWG682
Associated Gene	Lr37 (Triticum) Sr38 (Triticum) Yr17 (Triticum)
Gene Class	Reaction to Puccinia graminis Pers. Reaction to Puccinia recondita Rob. ex Desm. Reaction to Puccinia striiformis Westend.
Data Source	Soria, Marcelo A.
Remark	Trait marker Xcmwg682-2A Nearby marker on Composite map: Xcmwg682a Position on Composite map estimated by GrainGenes.
Probe for Locus	cMWG682
Locus	cMWG682 [ Show all 11 ]
Synonym	Synonym HAR35_1246   HAR35_1247   HAR35_34385
Reference	Sayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	T7 side (5' to 3') GCTCACTGCTTCGGAAAACAACGAC T3 side (5' to 3') ATAGCACCTCCAAAATAAGAGCCTT
Sequence	AJ234421 cMWG682 CMWG682-5
Linkage Group	2
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	0.8
Clone Vector	Bluescript pBS
Excision Enzyme	EcoRI
Clone Location	GrainGenes Probe Repository Graner, Andreas
Clone Authority	Graner, Andreas
Data Source	Graner, Andreas 94.03.08 Stein, Nils 2006.10 Kleinhofs, Andris 96.05.08
Gene Associated with Locus	Lr37 (Triticum)
Gene Class	Reaction to Puccinia recondita Rob. ex Desm.
Locus	Yr17/Lr37/Sr38
Reference	Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482. McIntosh RA WGS-95-1333-Ref#660.
Chromosome	2A Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome Arm	2AS Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Germplasm	Hexaploid stock Anza Lr37 Yr17 Sr38 Soria MA and Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Released germplasms. [ Show all 6 ]
Comment	Derived from T. ventricosa. Lr37 can be recognized in seedlings at low temperatures (17C) and is effective in adult plants under field conditions. See also Sr38 and Sr17. Hexaploid stocks: VPM1 derivatives (660).
Wheat Gene Catalog Reference	660 McIntosh RA WGS-95-1333-Ref#660.
Info Source	McIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator	Hart, Gary E. 95.08.24
Gene Associated with Locus	Sr38 (Triticum)
Gene Class	Reaction to Puccinia graminis Pers.
Locus	Sr38 Yr17/Lr37/Sr38
Reference	Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome	2A Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome Arm	2AS Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Germplasm	Hexaploid stock Anza Lr37 Yr17 Sr38 Soria MA and Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Released germplasms.   VPM1
Comment	Derived from Ae. ventricosa. Near-isogenic stocks and hexaploid stocks: see Lr37. RL6081 carries additional genes from Thatcher.
Info Source	McIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator	Hart, Gary E. 95.08.24
Gene Associated with Locus	Yr17 (Triticum)
Gene Class	Reaction to Puccinia striiformis Westend.
Locus	Yr17 Yr17/Lr37/Sr38
Reference	Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome	2A Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome Arm	2AS Bariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Germplasm	Hexaploid stock Anza Lr37 Yr17 Sr38 Soria MA and Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Released germplasms.
Comment	Hexaploid stocks: See Lr37 and Sr38. RL6081 probably carries Yr7.
Info Source	McIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator	Hart, Gary E. 95.08.24