GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Probe Report: Amy2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
Amy2A  [ Marker Report ]
Locus
amy2a
Reference
ReferencePortyanko VA et al. (2001) A linkage map of hexaploid oat based on grass anchor DNA clones and its relationship to other oat maps Genome 44:249-265.
General Remarks
Primer pair amplifies an intron in alpha-Amy2A
Type
PCR
STS
PCR primers
5' GCTACGCCTACATCCTCACC
5' CGCGATCTCTTCCTTGAATC
Sequence
AJ010728
Source Gene Class
alpha-Amylase
Source Gene
alpha-Amy2A (Avena)
Source Species
Avena fatua

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.