GrainGenes Probe Report: Bmag0381

GrainGenes Tools GrainGenes Database (the new MySQL version or the classic ACEDB one), sequence searches, map viewers.

Browse GrainGenes

Quick Queries

GBrowseBarley Bin Map
GrainMaps
Rice chromosomes vs. cereal genes
Wheat Physical EST Maps

Species PortalsData focused on individual crop species.

Avena Ave.

Barley Blvd.

Query Data Types Datasets of particular interest in GrainGenes SQL.

Maps An organized, annotated table of contents of the GrainGenes maps.

Genetic MarkersProbes, primers and genes, with links to mapped locations.

Sequences

QTLs

Gene ExpressionSequences from the Barley1 GeneChip, with links to BarleyBase.

Colleagues

Web ResourcesBesides the Database, the GrainGenes Website includes a large array of other data resources, classified by topic here. See also the "Search Website" button above.

Links to related sites

User ServicesJob openings, conference announcements, how to contribute your data, joining the grains mailgroup, ...

Database Information How to join the grains mailgroup.
About the GrainGenes Website and Database.

Query (optional)

in Class

GrainGenes Probe Report: Bmag0381

[ Printable Version ] [ Submit comment/correction ]

Probe

Bmag0381 [ Marker Report ]

Locus

Bmag0381

Reference

Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.

Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.

Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.

Type

SSR

PCR primers

TTTTATTATTGCATCTAGGGC
TATCAAGATCATGACGTCTCA


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.