GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Probe Report: CDO474

[ Printable Version ]  [ Submit comment/correction ]

Probe
CDO474  [ Marker Report ]
Locus
CDO474C
[ Show all 8 ]
External Databases
DDBJ
EMBL
GenBank
Reference
ReferenceHeun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks
Uni-ZAP XR library
OatUni-ZAPXR [c]
Type
cDNA
STS
PCR primers
TTTGGACCGTTCAGAGTTGC
ACGTCCTCTCCAAGGCCAAT
Sequence
CDO474
Linkage Group
[b 4L]
2
Insert Enzyme
EcoRI
XhoI
Source Species
Avena sativa
Source Germplasm
Brooks CIav9260
Source Tissue
etiolated leaf
Insert Size
1.6
PCR size
1.6
Clone Vector
pBluSK
pBS
Excision Enzyme
EcoRI
XhoI
Vector PCR primers
M13forward
M13reverse
Vector Amplification
94 C for 60 sec, 50 C 40 sec, 72 C 60 sec, 34 times; 94 C for 60 sec, 50 C 40 sec, 72 C 10 min, 1 time
Antibiotic
Ampicillin
Clone Location
Sorrells, Mark E.
Clone Authority
Sorrells, Mark E.
Blake, Tom
Data Source
Sorrells, Mark E.96.07
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.