| |
| |
| | Locus Source: Avena sativa (oat) |
|
| |
| |
| |
| |
| |
| | genbank | Release 141, Apr 15 2004 | | genbank | Downloaded 2008-2009 |
|
| | CDO524.R cDNA from oat Avena sativa cDNA clone CDO524, mRNA sequence. |
|
| |
| |
| | DB_xref: taxon:4498 | | Feature: source: mol_type = 'mRNA'; | | Feature: source: mol_type = 'mRNA' | | Locus Comment: Contact: McCouch SR; Dept Plant Breeding; Cornell University; Ithaca, NY 14853-1901, USA; Tel: 607 255 0420; Fax: 607 255 6683; Email: srm4@cornell.edu; cDNA from oat (Avena sativa); reverse sequence of RFLP probe; CDO524. Sequence determined by Nicola M. Ayres. For mapping; information, additional citations and other related information; concerning this probe, please refer to the RiceGenes database at; http: | | Note: Vector: Uni-ZAP XR/pBluescript; Site_1: EcoRI; Site_2: XhoI; A Uni-ZAP XR cDNA library was constructed from etiolated leaf mRNA from the oat cultivar 'Brooks' and converted to pBluescript (amp resistant) as described in Heun et al. (1991) Genome 34:437-447. For insert amplification, use M13 forward and reverse primers. Clones from this library are designated with the prefix 'CDO'. *Note: Clone CDO1081 was recloned into the TA cloning vector and carries kanamycin resistance. |
|
| tgagtattggctcacagaaggtgggcaaagtgcaactggcgctctgcttg
attacattgttgaaaaccatgtcgctgctccccttctagctaatcatgct
gcttctcaaagtgtatccatatttgagttgatgaacaagttattatcttc
aatgtcacatgaacaaaatatgccttttctttctgccttgagtcaagata
cccatgtccttccagattttcatggaaatcggtcccctgttgctgatcca
aaatccaaaggagtgaattgtggcttgacacttgatacaagtgaaaagca
tttatcgctctgta
|
|
| |
