| |
| |
| |
| |
| |
| |
| |
| | Locus Source: Triticum aestivum (bread wheat) | | UniGene title 'Transcribed locus, moderately similar to NP_195504.2 MTHSC70-1 (mitochondrial heat shock protein 70-1); ATP binding / unfolded protein binding [Arabidopsis thaliana]' |
|
| |
| |
| |
| |
| |
| | Wheat etiolated seedling root cDNA library |
|
| |
| | Five day old etiolated seedling |
|
| | genbank | Release 135, Apr 15 2003 | | genbank | Updated Nov 2006 |
|
| | WHE0435_A12_B23ZS Wheat etiolated seedling root cDNA library Triticum aestivum cDNA clone WHE0435_A12_B23, mRNA sequence. |
|
| | WHE0435_A12_B23ZS [ wEST-ACEDB ] [ wEST-mySQL ] |
|
| |
| |
| |
| |
| | DB_xref: taxon:4565 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Strategene SK primer. | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
|
| |
| atcgggatcgatttggggacgacaaactctgtgtctccgtcatggaaggc
aagacaccacgagtgattgagaatgctgaaggtgcgaggacaacaccctc
cattgttgccacaaacaacaaaggcgagatcttgatcggcatcactgcca
gtcggcaggcagtgacaaatgccgagaacacagttcgtgggtcaaagcgc
ctgattggtagagcttttgatgacccccaaacacagaaggaaatgaagat
ggtgccttacaagattgtcatgggaacaaatggtgatgcctgggtggaga
tggctgggaaatcatactccccaagccagattggtgcctttgttcttacc
aagatgaaggaaactgcagaggcttaccttggcaagtcggtctccaaggc
tgttattacagtcccagcttatttcaatgatgctcagcgtcaggccacca
atgatgctggtaggattgctgggttggacgtgatgaggattatcaatgag
cccactgctgcagc
|
|
| |
