| |
| |
| |
| |
| |
| |
| | Locus Source: Triticum aestivum (bread wheat) | | UniGene title 'Alpha/beta-gliadin precursor' |
|
| |
| |
| |
| |
| | Wheat endosperm cDNA library |
|
| |
| | 5 to 30 days post anthesis seed |
|
| | genbank | Release 135, Apr 15 2003 | | genbank | Updated Nov 2006 |
|
| | WHE0056_C09_E18ZS Wheat endosperm cDNA library Triticum aestivum cDNA clone WHE0056_C09_E18, mRNA sequence. |
|
| | WHE0056_C09_E18ZS [ wEST-ACEDB ] [ wEST-mySQL ] |
|
| |
| |
| |
| |
| | DB_xref: taxon:4565 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. | | Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab. |
|
| acatgatagtgcatgtgacattattttttcaccgctacaaggaccaaacc
atggactgagaaaacggtgtttcatatatctagtactagagttattttct
tctcagttagtaccgaagatgccaaatggcgcgatggtgcaatatggagg
gatgtagacattgcacattgcaggtagcgtctgtagggctaggttcctta
tttcctcgaactggggcagttgttgaggctggacagagccctgggcctgt
gggttttgctgagatggccggaaggagccctggcctaatggatattgttg
cagaggctgttggaaggagacctggctcgatggttgttgttgttgttttt
gttgt
|
|
| |