GrainGenes Home

 
Query (optional)   in Class 

GrainGenes Sequence Report: BE424223

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE424223
Contig
Ta.10098.1.S1_at
Ta.10098.1.S1_x_at
Ta.10098.2.S1_a_at
Ta.10098.3.S1_a_at
NSFT03P2_Contig3852
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC291765
NCBI UniGene
Ta.10098
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, moderately similar to NP_001048407.1 Os02g0799000 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
CHEYENNE
Species
Triticum aestivum
Cultivar
Cheyenne
Clone Library
Wheat endosperm cDNA library
Tissue
Endosperm
Developmental Stage
5 to 30 days post anthesis seed
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0075_B04_C07ZS Wheat endosperm cDNA library Triticum aestivum cDNA clone WHE0075_B04_C07, mRNA sequence.
Other Name
WHE0075_B04_C07ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA001E1X
Clone
WHE0075_B04_C07
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab.
DNA
tacactgatacaatagcaataaccagagaatggtttcttttacagacaaa
acttaaacagggggaacaacacatctcatcatctcataatgagcctcaaa
gccccctggatgcacgctactgactcccttaccaccctaattaagctccc
aacttatatttacaggtgcctcacgattcacaatggcgggtgagatcttc
ttcaggttcgttggttttattcccaggtaacaatagagccacaaactggc
atgtcgacgacgacggcggatcggtacttacagttgacactcaacaatgc
agaagaagaaggcggcgacaatggcgcgccgccgagatcactggccttcc
aggagcaccctgaggctatggagcccctcggccgagatgctccgctcgac
cctgcccgtcctgttcaccctgatctggggaggggcctcctggtggaacg
agaccatgaccgccgtcaggttgtcggtggcgccccgccggatcgcctcc
tccacgatctccttgcagcaccgccggaggtcgttgtggtcctggagcct
ccgccgcgc
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.