| |
| |
| |
| |
| | Locus Source: Hordeum vulgare | | UniGene title 'CDNA clone: FLbaf71e19, mRNA sequence' |
|
| |
| |
| | ITEC BCD Barley cDNA Library |
|
| |
| | genbank | Release 135, Apr 15 2003 | | genbank | Updated Nov 2006 |
|
| | BCD1194_WHE1H0042F ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD1194_WHE1H0042, mRNA sequence. |
|
| | BCD1194_WHE1H0042F  [ wEST-ACEDB ]  [ wEST-mySQL ] |
|
| |
| |
| | DB_xref: taxon:4513 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http: | | Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http: |
|
| |
| caaaccctagcctcctcctcctcctcgccgccgccgccgccgccgccgcc
gccatgtcagggaggaagaagacccgcgagcccaaggaggagaacgtgac
gctcggccccgccgtccgcgagggggagcacgtcttcggcgtcgcgcaca
tcttcgcctccttcaacgacactttcatccatgtcacggatctgtccggg
agggagacgctcgtccgcatcaccggtgggatgaaggttaaagctgatcg
tgatgaatcatccccttatgcagctatgcttgcatcac
|
|
| |