| |
| |
| | Locus Source: Avena sativa (oat) |
|
| |
| |
| | ITEC CDO Oat cDNA Library |
|
| |
| | genbank | Release 141, Apr 15 2004 | | genbank | Downloaded 2008-2009 |
|
| | CDO507_WHE04B09R ITEC CDO Oat cDNA Library Avena sativa cDNA clone CDO507_WHE04B09, mRNA sequence. |
|
| | CDO507_WHE04B09R [ wEST-ACEDB ] [ wEST-mySQL ] |
|
| |
| |
| | DB_xref: taxon:4498 | | Feature: source: mol_type = 'mRNA'; | | Feature: source: mol_type = 'mRNA' | | Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http: | | Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http: |
|
| |
| caggaattcggcacagccccgctccgcctcgctccacctctctctctgaa
agacccggaaggagcggagcgccgagtttgggacgagaccatcccccgtc
gcctcgcctccgcttccgaaggagagtaccatggcggaccaggccaacca
accgtctgttgttcaga
|
|
| |
