| |
| |
| |
| |
| |
| | Locus Source: Secale cereale (rye) |
|
| |
| |
| |
| |
| | Secale cereale anther cDNA library |
|
| |
| | Adult plant before anthesis |
|
| | genbank | Release 135, Apr 15 2003 | | genbank | Downloaded 2008-2009 |
|
| | WHE1270_F02_L04ZS Secale cereale anther cDNA library Secale cereale cDNA clone WHE1270_F02_L04, mRNA sequence. |
|
| | WHE1270_F02_L04ZS [ wEST-ACEDB ] [ wEST-mySQL ] |
|
| |
| |
| |
| |
| | DB_xref: taxon:4550 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Anthers were harvested and pooled from early meiosis to late meiosis. The tissue, total RNA, and poly(A) RNA were prepared (Butler, Ross and Gustafson) at University of Missouri, Columbia. A cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
|
| tggccacgccggccaccttcgacaaccagtactacatcaacctgctctcc
ggcgacggcctgctgccgtccgaccaggcgctggccgcgccctccggctc
cggggcggaggacgtcgcggcgctcgtgaccgactacgccttcgacgcgg
ccctcttcttcgacgacttcgcggcctccatgctgcggatggggaggctg
tcaccggccggcggccgtgacgccggagaggtccgccgtgactgccgtgt
ggtgaactagctagctagatagctagccaaggtcaggtcgattaagctga
gatgcttaacgcgctagcattggacttgggtagtgtgtagtggctttcag
ttagtttgatgtttcccatcgcgttgtgaaataagctgagatgcttaact
agtatgatgtatgatgatgcatggtgtagtgtatctggtgatgtgcggcg
ttcttggcttgtcaaaataattaatttcacgtgttggaggtg
|
|
| |
