| |
| |
| |
| |
| |
| | Locus Source: Triticum turgidum |
|
| |
| |
| |
| |
| |
| | Triticum turgidum L. var. durum (durum wheat) whole plant cDNA library |
|
| |
| |
| | genbank | Release 135, Apr 15 2003 | | genbank | Updated Nov 2006 |
|
| | WHE2162_A05_B10ZS Triticum turgidum L. var. durum (durum wheat) whole plant cDNA library Triticum turgidum cDNA clone WHE2162_A05_B10, mRNA sequence. |
|
| | WHE2162_A05_B10ZS [ wEST-ACEDB ] [ wEST-mySQL ] |
|
| |
| |
| |
| | DB_xref: taxon:4571 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in a growth chamber at North Dakota State University (Kianian, Otto, Simons). Tissues collected from seven-day etiolated seedling leaf, stem, root and seed; leaf from plant at fourth leaf stage; spike from pre-anthesis through 20 days after anthesis; flag leaf; leaf and stem tissue from tillers. and root. Total RNA and poly(A) RNA were prepared from each tissue and then pooled, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
|
| |
| atcaagcagcagtacgaggtggttaaagcgagaacggcacccccaaacga
gtccagtattggctctcatgtcatggagcagcgtttgcccagcctcaagg
gtgcaatcaatcaaagagatgccgacattcttttcatgtggaagaagtat
gagcagttaaatggtggatcagaggagaagcagagggctctcacggagat
caaagaaactgtgctacacaagaagcatctcgacagcagtatcgatttca
tcgggaagcttgtctttggattcgaaaagggtccttcagtgcttgacgct
gctagaggctctggccagccattggtcgacgattgggattgtctgaagac
gatggtgcgaattttcgagtctcagtgcggatcactcactcagtatggca
tgaagcacatgagggcgttcgccaacatatgcaacaatggcgtc
|
|
| |
