| |
| |
| |
| |
| |
| |
| | Locus Source: Triticum aestivum (bread wheat) | | UniGene title 'Elongation factor-2' |
|
| |
| |
| |
| |
| | Wheat salt-stressed sheath cDNA library |
|
| |
| |
| | genbank | Release 135, Apr 15 2003 | | genbank | Updated Nov 2006 |
|
| | WHE2051_C05_E09ZS Wheat salt-stressed sheath cDNA library Triticum aestivum cDNA clone WHE2051_C05_E09, mRNA sequence. |
|
| | WHE2051_C05_E09ZS [ wEST-ACEDB ] [ wEST-mySQL ] |
|
| |
| |
| |
| | DB_xref: taxon:4565 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA was prepared from sheath tissue, equal quantities of RNA were pooled from the two samples, polyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin , Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA was prepared from sheath tissue, equal quantities of RNA were pooled from the two samples, polyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
|
| gccgccgcttccccacctctcatctctcggcgaacccgcaaggaactata
ttcccagtgtgatatccaaaaccagtcaagatggtgaagtttacagcgga
ggagctccgcggaattatggacaagaaaaataatattcgtaacatgtctg
ttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg
gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgac
tgatacccgtgcagatgaggcagagcgtggtattacaatcaaatccacgg
gtatctctcttttctatcagatgactcctgaatcacttgagatgtacaag
ggcgacagggatggagatgaatacctgatcaaccttattgattcacctgg
ccacgttgacttttcttcggaagtcacagctgctcttcgtatcactgatg
gtgccttggtggttgttgactgcattgagggtgtctgtgtgcagactgaa
actgtgctgcgccaagctcttggtgagagga
|
|
| |
