| |
| |
| |
| |
| | Locus Source: Hordeum vulgare subsp. vulgare | | UniGene title 'Transcribed locus, strongly similar to NP_001049134.1 Os03g0175600 [Oryza sativa (japonica cultivar-group)]' |
|
| |
| |
| |
| | maternal, 12 DPA, no treatment, cv Optic, EBma05 |
|
| |
| |
| | genbank | Release 135, Apr 15 2003 | | genbank | Updated Nov 2006 |
|
| | EBma05_SQ001_G15_R maternal, 12 DPA, no treatment, cv Optic, EBma05 Hordeum vulgare subsp. vulgare cDNA clone EBma05_SQ001_G15 5', mRNA sequence. |
|
| |
| |
| |
| | DB_xref: taxon:112509 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Waugh R, Marshall DF; Genome Dynamics/Computational Biology; Scottish Crop Research Institute; Invergowrie, Dundee, DD2 5DA, Scotland, UK; Tel: 00 44 1382 562731; Fax: 00 44 1382 562426; Email: est@scri.sari.ac.uk; All sequence has a Phred quality score of 20 or over; Seq primer: M13 reverse. | | Note: Vector: pSPORT1; Site_1: Sal I; Site_2: Not I; Non-normalised library, directionally cloned into pSPORT1. Derived from maternal tissue dissected from developing grains (12 days post anthesis) in glasshouse grown barley plants. Developed as part of the barley transcriptome resources of BBSRC/SEERAD funded cereal IGF (Investigating Gene Function) project. |
|
| ctataggagcagagattgactattcattgattgagcagaggcggcaattc
cttcctctgcgacaccaacgacgtggagatctttatcagctggtagacgt
ccagggatcgggttccaagtagactgtcctcattgctcgcgccggcgtga
tccgtgaaagcaacagccgccgattgggaaggcaagctcaagctttcgga
tcgcgagatgatgagataatgtgcgagaaggggacagaaccaaataagga
gatactgtatgtaacatgtataactgcctgagttgcgaaataattgaacc
gcattggcaggaacaaaaatcgataaatgtcactcaacctgttggggtta
cttgtgctatgtttgagatgaagcaaacatggcatgattacttcatcca
|
|
| |
