| |
| |
| |
| | Locus Source: Triticum monococcum |
|
| |
| |
| |
| | Triticum monococcum vernalized apex cDNA library |
|
| |
| |
| | genbank | Release 135, Apr 15 2003 | | genbank | Updated Nov 2006 |
|
| | WHE2822_F09_K18ZS Triticum monococcum vernalized apex cDNA library Triticum monococcum cDNA clone WHE2822_F09_K18, mRNA sequence. |
|
| |
| |
| | DB_xref: taxon:4568 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; One-month old plants were subjected to vernalization treatment by placing them in the cold room at 6 C, under 15hr light/9hr dark condition. Total RNA was prepared from apex tissue extracted from plants with no cold treatment; and from plants with 2-week , 4-week and 6-week cold treatment separately. Equal amount of total RNA was pooled from all four samples, a cDNA library was made using pooled polyA RNA and cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky ). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; One-month old plants were subjected to vernalization treatment by placing them in the cold room at 6 C, under 15hr light/9hr dark condition. Total RNA was prepared from apex tissue extracted from plants with no cold treatment; and from plants with 2-week, 4-week and 6-week cold treatment separately. Equal amount of total RNA was pooled from all four samples, a cDNA library was made using pooled polyA RNA and cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
|
| gagggtctctgaccttaagaactatcttggtgctcggttctctctcaggg
atggtgacaagccccatgagatgaccttctaagttgctacaagttcctga
gttttggatgtgttttgcctagattgttgctgaaatttgtaccctgttag
ttgacttcctatgtcagttgaagtgaccgtaagatattatgagaaggtca
agagaatccttatctgctttggtggttctttttttacttatgcttaatgg
aacagtttgtcgtgcgttaaaaaaaaaaaaaaaaa
|
|
| |