| |
| |
| |
| |
| | Locus Source: Hordeum vulgare | | UniGene title 'Peptide transporter (ptr1)' |
|
| |
| |
| |
| |
| | leaf epidermis, 6 h and 24 h post inoculation with Blumeria graminis |
|
| |
| | genbank | Release 136, Jun 15 2003 | | genbank | Updated Nov 2006 |
|
| | HO10K21S HO Hordeum vulgare cDNA clone HO10K21 5-PRIME, mRNA sequence. |
|
| |
| |
| |
| | DB_xref: taxon:4513 | | Feature: source: mol_type = 'mRNA'; | | Locus Comment: Contact: Patrick Schweizer; Transcriptome Analysis, Cytogenetics Department; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, D-06466 Gatersleben, Germany; Tel: 0049 (0)39482-5660; Fax: 0049 (0)39482-5595; Email: schweiz@ipk-gatersleben.de; Insert Length: 450 Std Error: 0.00; Plate: 10 row: K column: 21; Seq primer: SK. | | Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); Approximately 5 % of the clones correspond to cDNA from the fungi B. graminis hordei and tritici, respectively. Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable. Average insert size is 1.2 kb |
|
| cggcacgaggggcaagcaagggtggatcccggacaacctcaacgtcggtc
acctcgactacttcttctggctgctcgccgcgctcagcctcgtcaacttc
gccgtctacctgctcatcgccagctggtacacctacaagaagaccgccga
agattctccggacgccaaaggaggagctcatgatcagtgagtgactgact
gacatgctctgtctgcgattggtgtctgaatgtgttcaagagacaaaaca
taatacagtactagattgttgaaagaagaagaaaacaaggattgggactt
cagagctcagataggtgaaattaagggagggaaatgaaatgcatggtgtg
gtttgtgacctcaagaatcaagagtgttgtgttgttgattaattctagtg
cttggaaaaatctggcagaaacaaagttcagatgtcaagttctttagctt
|
|
| |
