| |
| |
| |
| |
| | Locus Source: Triticum aestivum (bread wheat) | | UniGene title 'Transcribed locus, moderately similar to NP_001058889.1 Os07g0147800 [Oryza sativa (japonica cultivar-group)]' |
|
| |
| |
| |
| | Wheat Fusarium graminearum infected spike cDNA library |
|
| |
| |
| | genbank | Release 141, Apr 15 2004 | | genbank | Updated Nov 2006 |
|
| | WHE3951_B07_C13ZS Wheat Fusarium graminearum infected spike cDNA library Triticum aestivum cDNA clone WHE3951_B07_C13, mRNA sequence. |
|
| |
| |
| |
| | DB_xref: taxon:4565 | | Feature: source: mol_type = 'mRNA'; | | Feature: source: mol_type = 'mRNA' | | Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20. No effort was taken; to identify ESTs of fungal origin from this library, thus this EST; could be of wheat or fungal origin.; Seq primer: SK primer. | | Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes were sprayed at anthesis with Fusarium graminearum. Total RNA, and poly(A) RNA were prepared and pooled from infected spike at 0, 6, 12, 24, 36 and 48 hours after inoculation, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in G. Muehlbauer lab at the University of Minnesota (Kruger, W.M., Muehlbauer, G.J., Pritsch, C., Vance, C.). The cDNA library should contain genes of both wheat and fungal pathogen origin. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
|
| cggcacgaggaaacaaggttactgcactcctaagtattgcgcaaaagata
tatgtgactctcgagcattattctcctgtctttcagcagtatcctgggtt
actgggtgctttcttgaagacatgcaagcttgttgcaggtctacggaata
aacaaaaggatgacttaaaagatgcaacataagttggagctgctagataa
tgtaggttctaaattttgttgggagaggcttaggaggtgctagaaagcta
ttgatgtcatgatggagtaaacaatatcctactaaaagtatctgcccaaa
ttgactatgcaaattgatagacattacgaagttgtgggtgtctatcagac
tgaatgttgaaagccgggggttataaatagaagctaggtgcactgcgcat
agctttctgatttctatacgcatatggctaaacaaaatgtgaatactttg
ttcagttgtttcatagttggccactctgcagatggtatattcacatgttg
tattgtgtatgtataagtgaatattgaatgtcatctttttgcgagggaat
attgaatgacatttacggcatgcttaattcaaaaaaaaaaaaaaaaaaaa
a
|
|
| |
