Barley Genetics Newsletter (2009) 39:5-12

Optimization of conditions for assessment of genetic diversity in barley (Hordeum vulgare L.) using microsatellite markers

^1,2Ibrar Ahmed, ^1,3Madiha Islam, ¹Abdul Mannan, ¹Rehan Naeem and ¹Bushra Mirza*

¹Department of Biochemistry, Quaid-i-Azam University, Islamabad, Pakistan.

²Allan Wilson Center for Molecular Ecology and Evolution, Massey University, Private Bag 11 222, Palmerston North, New Zealand

³Department of Genetics, Hazara University, Mansehra, Pakistan

*Corresponding Author: bushra_dr@yahoo.com, 051-90643007

Abstract

Microsatellites are among the most informative and popular class of molecular markers for assessment of genetic diversity both in animals and plants. For reliable inference of results, however, optimization of various conditions involved is a pre-requisite. The present study was carried out to optimize conditions for assessment of genetic diversity in barley (Hordeum vulgare L.) using microsatellite markers. Parameters optimized for 14 SSR markers included template DNA concentration, simple and hot-start PCR, primer and MgCl₂ concentration and polyacrylamide gel conditions for fine resolution of amplicons. Two PCR profiles, each for a set of 7 markers, differing in primer annealing temperatures were used. An optimal template DNA concentration with consistent results was found to be 50ng for 25µL reaction volume, while no results were observed with 500ng template DNA for 25μL reaction volume. Hot-start PCR gave better results than simple PCR. Optimal concentrations for primers and MgCl₂ were 0.20μM and 2mM, respectively. Out of various combinations of polyacrylamide gel used in optimization, the best resolution of bands for 20cm x 1.5mm vertical gel was obtained for 10% gel from 20% (19:1 ratio of acrylamide: bis-acrylamide) stock solution, ½ X TBE (45mM Tris, 45mM Borate, 1.25mM EDTA) in gel as well as in running buffer at 100V of constant power supply for 3-4 hours depending upon sizes of amplicons.

Keywords: Optimization, PCR, microsatellites, template DNA, hot-start PCR, polyacrylamide gel.

Introduction

Microsatellites, also called Simple sequence repeats (SSRs) (Tautz, 1989) are short DNA stretches of tandem repeat units of 1-6 base pairs in length that exhibit a co-dominant mode of inheritance (Johansson et al. 1992). Such motifs are abundant and highly polymorphic in the genome of eukaryotes (Toth et al. 2000), both in protein coding and non-coding regions of DNA. High levels of polymorphism are to be expected because of the proposed mechanism responsible for generating SSR allelic diversity by replication slippage (Tautz et al. 1986). The unique sequences flanking such repetitive motifs are used to design forward and reverse primers for detection of length polymorphism via PCR (Litt & Luty, 1989; Weber & May, 1989). Microsatellite linkage maps have been developed for many organisms including human (Engelstein et al. 1993; Dib et al. 1996), Arabidopsis (Bell & Ecker, 1994), maize (Senior & Heun, 1993), mouse (Dietrich et al. 1996), rice (McCouch et al. 1997), wheat (Röder et al. 1998) and barley (Ramsay et al. 2000), giving boost to population genetics studies in such organisms.

An important limitation, however, regarding use of microsatellites for polymorphism studies is the prior need for optimization of PCR conditions for each SSR marker, since primers vary in length as well as in nucleotide length (Ogliari et al. 2000). Amplifications may not be obtained for the reported conditions due to involvement of many factors such as different types / brands of thermocyclers, reaction components, or even minor differences in thickness of walls of PCR tubes (Dograr & Akkaya, 2001). In addition, quality and quantity of template DNA obtained with different DNA extraction protocols may also affect the PCR results. Optimization of conditions is generally achieved by changing one factor at a time, however, this may lead to sub-optimal results since interactions between conditions are difficult to detect with this approach (Niens et al. 2005). To address this problem, factorial designs, or procedures involving changes in more than one factor in single PCR have been proposed (Cobb & Clarkson, 1994; Bencina, 2002; Niens et al. 2005). The present study forms part of a project for assessment of genetic diversity in barley accessions from seven countries of West Asia and North Africa. PCR conditions were optimized for 14 SSR markers in barley (Hordeum vulgare L.) as results were not obtained at originally reported conditions. In addition to PCR, polyacrylamide gel concentrations were also optimized to differentiate microsatellite alleles differing in the order of 2-3bp in size.

Materials and Methods

Barley germplasm used in this study was obtained from Plant Genetic Resources Institute, (PGRI), National Agriculture Research Centre (NARC) Islamabad, Pakistan. Barley seeds were germinated on 1% plane agar medium in aseptic and growth room conditions (25±1°C, 16 hours of photoperiod for 14 days). DNA extraction was carried out using our modified rapid plant DNA extraction protocol (Ahmed et al. 2009). DNA was quantified at 260nm wavelength by UV-spectrophotometer (Agilent, 8453) and dilutions of known concentrations were prepared. A total of 14 SSR markers previously reported (Ramsay et al. 2000), with each of 7 chromosomes represented by 2 markers were used in this study. Sequences of forward and reverse primers, repeat motifs, expected band sizes, PCR profiles and chromosomal locations of these markers are given in Table 1. PCR reactions were carried out for 25μL of reaction volume. Two types of reactions were carried out; simple and hot-start PCR using T1 (Biometra) and PxE 0.2 (Thermo Electron Corporation) thermocyclers, respectively. Reaction mixtures included template DNA (50-500ng), forward and reverse primers (0.15-0.30μM), MgCl₂ (1.5-2.5mM), dNTPs (0.2mM), Taq. DNA polymerase (Fermentas) (1U), 1X PCR buffer (50mM KCl + 10mM Tris-HCl, pH 8.3). Two PCR profiles A and B, each for 7 markers, were used as given in Table 1. These profiles were same for simple as well as for hot-start PCR. Factorial design for PCR involving changes in more than one parameter in one reaction was used for optimization. The amplicons were run on 1.5% agarose gel in 1X TBE buffer, stained with ethidium bromide (500ng/mL), visualized on UV-transilluminator and photographed with Olympus camera with DOC-IT software. For sizing of amplicons, 20cm x 1.5mm vertical polyacrylamide gels (Gibco BRL, Life Technologies) were optimized. Eight different combinations were used, as given in Table 2. All gels were run at 100V constant power supply for 3-4 hours.

Table 1. SSR markers used with forward and reverse primer sequences, repeat motifs, expected size of PCR products, PCR profiles used and Chromosomal location of the markers.

S.N	SSR	Forward primer	Reverse primers	Repeat motif	Size	PP	Ch
1	Bmac0213	ATGGATGCAAGACCAAAC	CTATGAGAGGTAGAGCAGCC	(AC)23	168	A	1H
2	HvHVA1	CATGGGAGGGGACAACAC	CGACCAAACACGACTAAAGGA	(ACC)5	136	B	1H
3	Bmac0134	CCAACTGAGTCGATCTCG	CTTCGTTGCTTCTCTACCTT	(AC)28	148	B	2H
4	EBmac0615	AATTGGTTCGAGTCATAGCT	CTAGTGGGTGTATGCAAGTG	(TG)5CG(TG)3,(TG)10	173	B	2H
5	Bmag0013	AAGGGGAATCAAAATGGGAG	TCGAATAGGTCTCCGAAGAAA	(CT)21	155	A	3H
6	Bmag0023	AACACAGACCTACGGGTC	CATGAGATAGATCCAAGCAC	(AG)18	137	B	3H
7	Bmag0490	TGATACATCAAGATCGTGACA	GGGACTGAGTGTATGAATGAG	(AG)24	121	B	4H
8	EBmac0701	ATGATGAGAACTCTTCACCC	TGGCACTAAAGCAAAAGAC	(AC)23	149	B	4H
9	Bmac0163	TTTCCAACAGAGGGTATTTACG	GCAAAGCCCATGATACATACA	(AC)6(GC)3(AC)17	146	B	5H
10	HvLOX	CAGCATATCCATCTGATCTG	CACCCTTATTTATTGCCTTAA	(AG)9	150	A	5H
11	Bmac0040	AGCCCGATCAGATTTACG	TTCTCCCTTTGGTCCTTG	(AC)20	236	A	6H
12	Bmag0500	GGGAACTTGCTAATGAAGAG	AATGTAAGGGAGTGTCCATAG	(AG)6CG(AG)29(AGAGGG)3(AG)6	150	A	6H
13	EBmac0603	ACCGAAACTAAATGAACTACTTCG	TGCAAACTGTGCTATTAAGGG	(CA)10	149	A	7H
14	HvID	GACATTTTTTATAAATTAAGAGCG	ATTAACAATCTGCATTAATTGTG	(AC)16(AT)10	182	A	7H

PP = PCR profiles, A: One cycle of 94°C for 3 min, 58°C for 1 min, 72°C for 1 min, followed by 35 cycles of 94°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, followed by last step of 72°C for 5 min. B: One cycle of 94°C for 3 min, 55°C for 1 min, 72°C for 1 min, followed by 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, followed by last step of 72°C for 5 min.

(Ch. = Chromosomal position.)

Table 2. Combinations of polyacrylamide gels used for optimization of fine band resolution.

	1X TBE buffer	½ X TBE buffer
8% gel	I	II	20% (19:1) stock solution
	III	IV	30% (29:1) stock solution
10% gel	V	VI	20% (19:1) stock solution
	VII	VIII	30% (29:1) stock solution

Results and Discussions

The important parameters optimized are discussed individually as under:

1. Template DNA concentration

One of the most important parameters to be optimized is template DNA concentration, as quality and quantity of template DNA greatly affects PCR success. Some DNA extraction protocols do not require DNA to be quantified for use in PCR. One possible reason for non-amplification or inconsistent results of PCR with DNA extracted by such protocols is unknown concentration of template DNA, although in most of the cases template DNA concentration is defined for PCR. Various researchers used different template DNA concentrations; 20ng for 10μL reaction volume (Saghai-Maroof et al. 1994), 50ng for 10μL reaction volume (Buyukunal-Bal & Akkaya, 2002), 100ng for 25μL reaction volume (Malysheva-Otto et al. 2006) etc. We tried two different concentrations of template DNA, 100ng and 500ng for 25μL reaction volume. Results were positive with 100ng, but absent with 500ng template DNA concentration (Fig. 1a, b). Further optimization with narrower range of template DNA concentration (50-150ng) showed that the best optimal / consistent results were observed with 50ng template DNA for 25μL reaction volume. These findings are in agreement with previous reports (Kramer & Coen, 2004) that too much template DNA may decrease PCR efficiency due to contaminants in DNA preparations.

2. Simple and hot-start PCR

What happens prior to thermocycling is critical for the success of PCR. Taq DNA polymerase retains some activity even at room temperature. Thus products can be generated from annealing of primers to target DNA at locations of low complementarity or having complementarity of just a few nucleotides at 3´ end. This, in turn, reduces amplification efficiency of specific products by competition for substrates or polymerase (Kramer & Coen, 2004). Cooling PCR reaction mixtures to 0°C before thermocycling and then transferring PCR tubes directly to 95°C pre-heated thermocycler block may improve chances of success of PCR (Kellogg et al. 1994). Dograr and Akkaya (2001) used hot-start PCR during optimization for amplification with wheat SSR markers. In the present study too, hot-start PCR proved to produce better amplifications than simple PCR (Fig. 1a, b).

3. Primers and MgCl₂ concentration

Variable concentrations of forward and reverse primers of different markers are reported in literature. Dograr and Akkaya (2001) used 50pmol (50μM / L) forward and reverse primers in optimization of PCR with wheat SSR markers. Rahman et al. (2000) used 2.5pmol (2.5μM /L) of each primer in SSR optimization with coniferous trees. Ramsay et al. (2000) used 0.3μM of each primer for barley SSR analysis. The primer concentration in present study was kept in the range of 0.15-0.30μM. Similarly the importance of optimal Mg⁺² concentration for PCR is well recognized (Innis & Gelfand, 1990). Determination of optimal MgCl₂ concentration which can vary even for different primers from the same region of a given template (Saiki, 1989) can have enormous influence on PCR success. Increased Mg⁺² concentration enhances Taq. activity up to a certain limit, above which it may act as a depressant of it (Kramer & Coen, 2004). In optimizing MgCl₂ concentration, Rahman et al. (2000) used 0.5-3.5mM MgCl₂ concentration and observed best results at 1mM of MgCl₂. In present study, we used 1.5-2.5mM MgCl₂ although the results were positive for three concentrations of primers as well as MgCl₂, more uniform results were obtained with all 14 SSR markers at 0.20μM primer and 2mM MgCl₂ concentrations (Figure 1a, b).

4. Resolution of PCR bands on gels

Agarose, polyacrylamide, denaturing PAGE and capillary electrophoresis are used to detect presence and determine sizes of SSR amplicons in order to determine size polymorphism (Holton, 2001). In this study, presence of PCR amplicons was confirmed on 1.5% agarose gels in 1X TBE (89mM Tris, 89mM Boric acid, 2.5mM EDTA) buffer. More sharp bands were observed with freshly prepared agarose gels stained with ethidium bromide (500ng / mL) than to re-used agarose gels. For measurement of sizes of PCR amplicons, vertical gels (PAGE) of 20cm x 1.5mm dimensions were optimized. Out of 8 different gel combinations (Table 2), best band resolution (Fig. 2) was obtained with combination VI (10% gel in ½ X buffer and 20% stock solution with 19:1 ratio of acrylamide : bisacrylamide).

Conclusion

In our study, best results were obtained with 50ng DNA for 25µL reaction volume, 0.2µM primer and 2mM MgCl₂ concentrations. Thus we recommend that with DNA extraction protocols not requiring quantification of DNA, it would be better to quantify DNA for consistent results. Hot-start PCR produced better and sharp bands. Polyacrylamide gel at a concentration of 10% prepared from 20% stock solution (19:1 ratio of acrylamide : bisacrylamide) in ½ X TBE buffer proved to be the best for clear band resolution.

(a)

(b)

Figure 1. (a = Samples 1-14 of hot-start PCR, b = Samples 15-26 of simple PCR. Odd numbered samples with no amplification for 500ng, even numbered samples with amplifications for 100ng template DNA concentration. All results shown are with 0.2µM primer and 2mM MgCl₂ concentrations).

Figure 2. Polyacrylamide gel (10%) in ½ X TBE buffer and 20% stock solution with 19:1 ratio of Acrylamide:bisacrylamide, run at 100V for 3 hours. (with 10bp ladder, SM1313, Fermentas).

Acknowledgements

The authors acknowledge financial support from Pakistan Science Foundation. This work was undertaken as part of an ongoing project funded by the Pakistan Science Foundation for estimation of genetic diversity using microsatellite markers in barley landraces from West Asia and North Africa regions.

References

Ahmed I, Islam M, Arshad W, Mannan A, Ahmad W, Mirza B. 2009. High quality plant DNA extraction, suitable for PCR; is it still a problem? J. Appl. Genet. Accepted for publication.

Bell, C.J., and J.R. Ecker. 1994. Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Genomics, 19: 137-144.

Bencina, M. 2002. Optimization of multiple PCR using a combination of full factorial design and three dimensional simplex optimization methods. Biotechnol. Lett., 24: 489-495.

Buyukunal-Bal, E.B., and M.S. Akkaya. 2002. Assessment of two highly polymorphic barley microsatellite marker for detecting the polymorphism in wheat. Turk. J. Biol., 26: 9-12.

Cobb, B.D., and J.M. Clarkson. 1994. A simple procedure for optimising the polymerase chain reaction (PCR) using modified Taguchi methods. Nucleic Acids Res., 22(18): 3801-3805.

Dib, C., S. Fauré, D. Fizames, D. Samson, N. Drouot, A. Vignal, P. Millasseau, S. Marc, J. Hazan, E. Seboun, M. Lathrop, G. Gyapay, J. Morissette, and J. Weissenbach. 1996. A comprehensive genetic map of the human genome based on 5264 microsatellites. Nature, 380: 152–154 and supplement.

Dietrich, W.F., J. Miller, R. Steen, M.A. Merchant, D. Damron-Boles, Z. Husain, R. Dredge, M.J. Daly, K.A. Ingalls, J. Tara, C.A. O'ConnorEvans, M.M. DeAngelis, M. David. , L.L.Kruglyak, N. Goodman, N.G. Copeland, N.A. Jenkins, T.L. Hawkins, L. Stein, D.C. Page, and E.S. Lander. 1996. A Comprehensive genetic map of the mouse genome. Nature, 380: 149-152.

Dograr, N., and M.S. Akkaya. 2001. Optimization of PCR amplification of wheat simple sequence repeat DNA markers. Turk. J. Biol., 25: 153-158.

Engelstein, M., T.J. Hudson, J.M. Lane, M.K. Lee, B. Leverone, G.M. Landes, E. Peltonen, J.L. Weber, and N.C. Dracopoli. 1993. A PCR-based linkage map of human chromosome 1. Genomics, 15: 251-258.

Holton, T.A. 2001. Plant Genotyping by Analysis of Microsatellite. In: Plant Genotyping the DNA Fingerprinting of Plants, United Kingdom: CAB International Wallingford.

Innis, M.A., and D.H. Gelfand. 1990. Optimization of PCR’s. In: PCR Protocols: A Guide to Methods and Applications, New York: Academic Press.

Johansson, M., H. Ellegren, and L. Adersson. 1992. Cloning and characterization of highly polymorphic porcine microsatellites. Heredity, 83: 196-198.

Kellogg, D.E., L. Tybalkin, S. Chen, N. Mukhamedova, T. Vlasik, P.D. Siebert, A. Chencik. 1994. TaqStart antibody: “Hot start” PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase. Biotechniques, 16: 1134-1137.

Kramer, M.F., and D.M. Coen. 2004. Enzymatic Amplification of DNA by PCR: Standard Procedures and Optimization. In: Current Protocols in Molecular Biology, United States of America: John Wiley and Sons, Vol. 2, pp. 15.1.1-15.1.14.

Litt, M., and J.A. Luty. 1989. A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Am. J. Hum Genet., 44: 397-401.

Malysheva-Otto, L.V., M.W. Ganal, and M.S. Röder. 2006. Analysis of molecular diversity, population structure and linkage disequilibrium in a worldwide survey of cultivated barley germplasm (Hordeum vulgare L.). BMC Genet., 7(6): 1-14.

McCouch S.R., X. Chen, O. Panaud, S. Temnykh, Y.  Xu, Y.G. Cho, N.  Huang, T. Ishii, and M. Blair. 1997. Microsatellite marker development, mapping and applications in rice genetics and breeding. Plant Mol. Biol., 35: 89-99.

Niens, M., G.T. Spijker, A. Diepstra, and G.J. te Meerman. 2005. A factorial experiment for optimizing the PCR conditions in routine genotyping. Biotechnol. Appl. Bioc., 42: 157-162.

Ogliari, J.B., R.L. Boscariol, and L.E.A. Camargo. 2000. Optimization of PCR amplification of maize microsatellite loci. Genet. Mol. Biol., 23(2): 395-398.

Rahman, M.H., B. Jaquish, and P.D. Khasa. 2000. Optimization of PCR protocol in microsatellite analysis with silver and SYBR stains. Plant Mol. Biol. Rep., 18: 339-348.

Ramsay, L., M. Macaulay, S. degli Ivanissevich, K. MacLean, L. Cardle, J. Fuller, K. J. Edwards, S. Tuvesson, M. Morgante, A. Massari, E. Maestri, N. Marmiroli, T. Sjakste, M. Ganal, W. Powell, and R. Waugh. 2000. A simple sequence repeat-based linkage map of barley. Genetics, 156: 1997-2005.

Röder, M.S., V. Korzun, K. Wendehake, J. Plaschke, M.H. Tixier, P. Leroy, and M.W. Ganal. 1998. A microsatellite map of wheat. Genetics, 149: 2007-2023.

Saghai-Maroof, M.A., R.M. Biyashev, G.P. Yang, Q. Zhang, and R.W. Allard. 1994. Extraordinary polymorphic microsatellite DNA in barley: species diversity, chromosomal locations and population dynamics. Proc. Natl. Acad. Sci. U. S. A., 91: 5466-5470.

Saiki, R.K. 1989. The Design and Optimization of the PCR. In: PCR Technology: Principles and Applications for DNA Amplification, New York: Stockton press.

Senior, M.L., and M. Heun. 1993. Mapping maize microsatellites and polymerase chain reaction confirmation of the targeted repeats a CT primer. Genome, 36: 884-889.

Tautz, D., M. Trick, and G.A. Dover. 1986. Cryptic simplicity in DNA is a major source of variation. Nature, 322: 652-656.

Tautz, D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nuceic Acids Res., 17: 6463-6471.

Tóth, G., Z. Gáspári, and J. Jurka. 2000. Microsatellites in different eukaryotic genomes. Genome Res., 10: 967-981.

Weber, J.L., and P.E. May. 1989. Abundant class of human DNA polymorphism which can be typed using the polymerase chain reaction. Am. J. Hum. Genet., 44: 388-396.