RAPD-derived markers flanking the Mla resistance gene cluster in barley
Karin S. Gobelman-Werner and Roger P. Wise
Corn Insects and Crop Genetics Research, U.S. Department of Agriculture-Agricultural Research Service, (USDA-ARS) and Department of Plant Pathology, Iowa State University, Ames, IA 50011-1020, U.S.A.
Names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of the name by USDA implies no approval of the product to the exclusion of others that may also be suitable.
Address correspondence to:
Roger P. Wise, USDA-ARS
Department of Plant Pathology
Iowa State University
Ames, IA 50011-1020 USA
Phone: 515-294-9756
Fax: 515-294-9420
E-mail:
Abstract
Over 30 variants of the Mla (powdery mildew) resistance cluster on chromosome 5 (1H) have been identified in barley. In this report, we describe the use of RAPDs (Random Amplified Polymorphic DNAs) and bulked segregant analysis to identify DNA markers flanking the Mla cluster. Seven hundred and thirty-nine RAPD primers were used to compare pools of recombinant lines that contained the (Mla6 + Mla14) or the (Mla13 + Ml-Ru3) resistance specificities, respectively. A 1500-bp DNA fragment amplified by primer OPA-10 mapped between Hor1 and XChs3. Similarly, a 950-bp DNA fragment amplified by primer UBC-465 is located between XChs3 and Xmwg068. Finally, a 1626-bp DNA fragment amplified by primer UBC-165 mapped 0.28 cM proximal to the Mla cluster. Twenty sequenced-tagged site (STS) primers were developed from the UBC-1651626 sequence. Eight STS products amplified from UBC-1651626 primers mapped 0.28 cM distal to the Mla resistance cluster. One of these STS primer pairs, designated P0 and P1034RC was used to identify tightly linked YAC clones from the cultivars Ingrid and Franka.
Introduction
Obligate fungal pathogens (e.g., rusts and mildews) are perhaps the greatest deterrent to cereal production worldwide. Powdery mildew of grasses (barley, wheat, rye, and oats) is caused by the obligate fungal pathogen, Erysiphe (Blumeria) graminis DC. Merat Em. Marchal. Powdery mildew is consistently an important disease of barley, resulting in reduced grain yield, kernel weight, and grain protein. It is most damaging in cool, wet climates, such as Northern Europe and the winter growing season in the Mid-Atlantic and Southeastern U.S. The primary means of disease control is by incorporation of genetic resistance into elite varieties.
Our long-range goal is to discern the fundamental signaling mechanisms between a plant cell and fungal pathogen, specifically how pathogen recognition triggers an active defense response. An ideal system for these investigations in cereal crops is the Mla (powdery mildew) resistance-gene cluster in barley. Thirty variants of this cluster have been identified in different cultivars, each giving a race-specific response to different isolates of E. graminis f. sp. hordei (Jørgensen 1994; Kintzios et al. 1995). This extensive variability provides an ideal research tool to explore the mechanisms of specific recognition of cereal hosts to obligate fungal biotrophs, as well as the evolution of new resistance-gene specificities.
Genes encoding resistance determinants are usually identified only by their phenotype. Thus, in large-genome cereal crops such as barley, a map-based approach is one of the only alternatives for gene discovery. In this report, we describe the identification and characterization of RAPD (Random Amplified Polymorphic DNA)-derived markers flanking the Mla cluster for use in map-based gene isolation.
Materials and Methods
Barley Germplasm:
The high-resolution mapping population derived from a cross between the two near-isogenic lines C.I. 16151 and C.I. 16155 has been described previously (Mahadevappa et al. 1994; DeScenzo et al. 1994). The Franger (C.I. 16151) and Rupee (C.I. 16155) derived lines contain the Mla6 + Mla14 and the Mla13 + Ml-Ru3 resistance specificities, respectively. Starting from 3,600 gametes (1800 F2 seed), a total of 286 recombinant barley lines were identified to be recombinant between and homozygous at the Hor1 and Hor2 loci. Three sub-sets were established from the high-resolution mapping population: 1) pools for bulked segregant analysis, 2) a recombinant interval population, and 3) a focused high-resolution population.Bulk design and sub-populations: A 3-cM window between Xbcd249.1 and Xmwg036, two previously mapped RFLP markers flanking the Mla cluster, was defined via the recombination breakpoints in our high-resolution, recombinant population (DeScenzo et al. 1994). Fourteen individual plants derived from the high-resolution recombinant population were used to create bulks that were homogeneous for the (Mla6 and Mla14) or the (Mla13 and Ml-Ru3) resistance specificities, respectively (Giovannoni et al. 1991; Michelmore et al. 1991). Individual DNAs were isolated, quantified, and combined into the two pools.
The recombinant interval mapping population is comprised of 18 individual homozygous lines, each containing a unique recombination breakpoint in the Hor1 – Hor2 interval on chromosome 5 (1H) (shown in
Figure 1). This interval population was used to quickly assess if the RAPD was tightly linked to Mla. The focused high-resolution population is comprised of 89 individual lines that contain recombination breakpoints in the Xmwg036 - Xmwg068 interval. A population of 150 double haploid lines comprises the Steptoe X Morex population developed by the North American Barley Genome Mapping Project (NABGMP) (Kleinhofs et al. 1993). Out of this population, 15 were selected as a subset to quickly map markers to a particular chromosome (Mgonja et al. 1995).Powdery mildew resistance screening: Barley seedlings were inoculated with the 5874 (Avr Mla6, vir Mla13, vir Ml-Ru3), A27 (vir Mla6, Avr Mla14, Avr Mla13), and R63 (vir Mla6, Avr Ma14, vir Mla13, vir Ml-Ru3) isolates of E. graminis f. sp. hordei and screened for infection type as previously described (Mahadevappa et al. 1994). The infection types 0, 1, or 2 were considered resistant reactions while the infection types 3 or 4 were considered susceptible reactions (Wise and Ellingboe 1983).
Plant DNA isolation: Barley DNA was extracted from 0.5 g samples of frozen tissue using a modified hexadecyl trimethylammonium bromide (CTAB) method for fresh tissue (Bush et al. 1994; Wise and Schnable 1994) and quantified using a GeneQuant II spectrophometer (Pharmacia, Piscataway, NJ). DNA was diluted in sterile double distilled water to a final concentration of 50 ng/µl.
RAPD and STS analysis: RAPD analysis was carried out using 10-base oligonucleotide primers synthesized from both Operon Technologies Inc. (Alameda, CA) and Oligonucleotide Synthesis Laboratory (University British Columbia, Vancouver, Canada). PCR amplification was performed in a 25 µl a reaction volume with a 1x reaction buffer supplied by the manufacturer [20 mM Tris-HCl (pH 8.4), 50 mM KCl], 1.5 mM MgCl2, 0.001% gelatin, 0.1 mM each of dNTP, either 5 µM decamer RAPD- or 20 µM STS-primer, 50 ng of genomic DNA, and 0.625 units of Taq DNA polymerase (Gibco BRL, Rockville, MD). The followed programs were used for amplification; for RAPD: one cycle for 1 min at 94°; 44 cycles for 5 sec at 94°, 30 sec at 36°, 1 min at 72°; with a final extension of 9 min at 72°; for the STS analysis: one cycle for 3 min at 94°; 29 cycles for 30 sec at 94°, 1 min at 60°, 1 min at 72°; with a final extension of 4 min at 72°. All PCR amplifications were performed in a PTC-100 programmable thermocycler (MJ Research Inc., Watertown, MA). Amplification products were resolved by electrophoresis at 80 volts (V) for 4 hr on a 2% thin (3 mm) agarose gel containing 1x TBE buffer (0.089 M Tris, 0.089 M Borate, 0.002 M Na2EDTA; Sambrook et al. 1989) and 1
m g/ml ethidium bromide.Cloning of polymorphic RAPD fragments: DNA fragments were isolated by extracting an agarose plug of the desired fragment with the small end of a pasteur pipet followed by placement of the plug in 100 µl sterile double distilled water (ddH2O) to elute overnight at 4°. One µl of eluted DNA / ddH2O solution was used as a template for re-amplification with the original 10-base oligonucleotide primer. Amplified DNA fragments were purified via a modified NA45 membrane (Schleicher & Schuell, Keene, NH) extraction, ligated into pGEM-T (Promega, Madison, WI), and transformed into the E. coli TB-1 host strain.
Sequence analysis and STS design: Primers were designed using the primer analysis software Oligo V5 [copyright 1989-1996, Wojceiech and Piotre Rychlik, National Bioscience, Inc. (NBI), Plymouth, MN]. Sequencing and oligonucleotide synthesis were performed at the Iowa State University DNA Sequencing and Synthesis Facility. The nucleotide sequence of the cloned RAPD fragment was determined by a Perkin-Elmer Applied system ABI model 377 automated DNA sequencing system. The sequenced-tagged site (STS) oligonucleotides were synthesized on a Perkin Elmer Applied System ABI model 394 DNA/RNA synthesizer. Sequence data was entered into the program AutoAssembler (Perkin Elmer, Modesto, CA). Sequence data was assembled using the "Assemble" command (10-bp pair overlap and 5% error).
Linkage Analysis: New RAPD marker data was entered into Map Manager V2.6.5 (copyright 1988-1994, K. Manly, Roswell Park Cancer Institute) file containing previous marker data for the Hor1-Hor2 high-resolution mapping population (DeScenzo et al. 1994). MAPMAKER readable files were created using the Export for MAPMAKER option. MAPMAKER Macintosh V2.0 (copyright 1993 E.I. DuPont de Nemours and Co., Lander et al. 1987) was used in the analysis of the segregation data. Markers were grouped together using the "Group" command (minimum LOD of 8.0) and ordered relative to the resistance locus using the "Try" command. Recombination frequencies were converted to genetic distances using Kosambi mapping function.
Results and Discussion
The objective of this research was to identify DNA-based markers linked to the Mla cluster suitable for large-insert clone isolation. RAPD primers (Williams et al. 1990) were used in conjunction with bulked segregant analysis (BSA) (Giovannoni et al. 1991) to saturate the Mla region. The RAPD technique has also been used to develop new molecular markers linked to the Mi nematode resistance gene in tomato (Klein-Lankhorst et al. 1991; Williamson et al. 1994), the Lr9 leaf-rust-resistance gene in wheat (Schachermayr et al. 1994), and the Pg3 stem-rust- resistance gene in oat (Penner et al. 1993).
There were several essential criteria for the development of specific molecular markers for map-based cloning of the individual Mla6, Mla14, Mla13, or Ml-Ru3 specificities:
1) Markers must be discrete, robust, and polymorphic between C.I. 16151 (Mla6 + Mla14) and C.I. 16155 (Mla13 + Ml-Ru3), the parents of our high-resolution mapping population. This polymorphism was essential to accurately position the marker relative to the different Mla specificities.
2)
3)
To screen super pools derived from the large insert libraries, allele-specific PCR primers developed from these markers should amplify the identical fragment from Ingrid (Büschges et al. 1997) and Franka (Kleine et al. 1993; 1997), the cultivars used to construct the barley YAC libraries, but not the AB1380 yeast host strain. To screen the Morex BAC library via high-density filter hybridization (Yu et al. 2000), the amplified product should hybridize to a low-copy fragment in the barley genome.RAPD analysis: Seven hundred thirty-nine arbitrary RAPD primers were evaluated to identify DNA polymorphisms between the C.I. 16151 (Mla6 + Mla14) and C.I. 16155 (Mla13 + Ml-Ru3) parents and the bulks. Zero to 18 DNA fragments were amplified for each primer for a total of 4819 discrete amplified products (2410 from C.I. 16151 and 2409 from C.I. 16155). Three primers amplified discrete polymorphic DNA fragments that were positioned between Hor1 and Hor2 via the low-resolution interval mapping population (
Figure 1).Primer OPA-10 (GTGATCGCAG) amplified a 1500-bp, C.I. 16155-specific fragment, designated OPA-101500, that was positioned between Hor1 and XChs3. Primer UBC465 (GGTCAGGGCT) amplified a 950-bp, C.I. 16151-specific fragment, designated UBC465950, that mapped between XChs3 and Xmwg068. Primer UBC165 (GAAGGCACTG) amplified a 1626-bp, C.I. 16151-specific fragment, designated UBC1651626, that mapped within the Xmwg036 - Xmwg068 interval. The UBC1651626–derived fragment was fine mapped using the 89 recombinants in the Xbcd249.1 - Xmwg036 interval. Of the 50 recombinants between Xbcd249.1 and Mla6, twelve had crossovers between Mla6 and UBC1651626, which equaled a genetic distance of 0.28 cM proximal to Mla6.
The 1626-bp UBC1651626 - derived fragment was cloned and used as a hybridization probe to test for copy number. Unfortunately, the cloned UBC1651626 fragment hybridized to a highly repetitive fraction of the barley genome. Therefore, we attempted to sub-fractionate this clone to obtain a small low-copy region. The 1626-bp fragment was digested with the restriction endonucleases PstI, SacII, AluI, HincII, HhaI, HaeIII, HinfI, and Sau3A. The digested fragments were size fractionated via agarose gel electrophoresis, transferred to nylon, and hybridized with total barley DNA to identify the repetitive regions. Subfragments that did not hybridize to the total barley DNA probe were used as individual hybridization probes onto small strip blots of HindIII digested barley DNA. Unfortunately, all of these UBC1651626-derived sub-fragments also hybridized to a middle-repetitive fraction, and therefore, could not be used as an RFLP marker or to screen high-density library filters. Therefore, we set out to develop robust STS markers that could be used for PCR screening.
Generation of STS markers: Twenty PCR primers were developed from the UBC1651626 sequence (
Table 1). The placement of the individual primers on the UBC1651626 sequence is shown in Figure 2. The original UBC165 RAPD primer is designated at both the 5' and 3' ends of the sequence. Various primers were used in combination to test for polymorphism between the C.I. 16151 (Mla6 + Mla14) and C.I. 16155 (Mla13 + Ml-Ru3) mapping parents and to verify amplification on Ingrid and Franka, the two cultivars used in YAC library construction. Figure 3 illustrates the different sizes of the fragments amplified throughout the UBC1651626 sequence. The dotted lines indicate that the amplified product was C.I. 16151 specific, whereas, the solid lines designate that the product was amplified in both the C.I. 16151 and C.I. 16155. Primers that originate from opposite sides of the 174-nucleotide position amplify polymorphic products, whereas, primers positioned on the same side result in monomorphic amplifications.We used the polymorphic primer combinations to position the UBC1651626-derived STS markers relative to the Mla locus. Out of the 20 STS primer combinations tested, 13 primer combinations amplified fragments that cosegregated with the Mla using the low-resolution, interval population. Figure 4 illustrates the interval mapping of the amplified products derived from two such STS primer pairs, Fr1062 and Fr1492.
Each of the 13 primer pairs that produced cosegregating fragments were tested on the 89 recombinant lines in the Xbcd249.1 - Xmwg036 interval. Eight of these polymorphic fragments were accurately positioned using the 89 recombinant lines in the Xbcd249.1 - Xmwg036 interval. As shown in Figure 5, the primers that amplified Fr1062, Fr106, Fr125, Fr226, Fr250, Fr860, Fr1350, and Fr1492 were all positioned 0.28 cM distal to Mla, in contrast to the original proximal position of the UBC1651626 RAPD marker. This demonstrated that different pair-wise combinations of primers developed from the UBC1651626 sequence yielded a number of genomic-PCR products, which all proved to be useful STS markers. The difference in map position is attributed to the specificity of the 18 – 20-nt STS primers, as compared to the 10-nt RAPD primers, and the repetitive nature of the DNA sequences that comprise the UBC1651626 fragment.
The amplification product produced by the Fr1062 primer pair P0 + P1034RC consistently yielded the most stable map position. Therefore, P0 and P1034RC were tested on various barley accessions to verify if the Fr1062 fragment could be amplified from Ingrid, Franka, and Morex, the cultivars used in YAC and BAC library construction. As shown in Figure 6, the identical 1062-bp fragment was amplified from Ingrid and Franka, the two cultivars utilized in YAC library construction (Büschges et al. 1997; Kleine et al. 1993; 1997), but not Morex, the cultivar utilized for BAC library construction (Yu et al. 2000). Although the UBC1651626 cloned fragment was absolutely ineffective as a hybridization probe, we show here that a number of STS primer pairs could be developed for effective PCR amplification, genetic mapping, and YAC library screening. This information was used towards the eventual molecular identification of the Mla cluster (Wei et al. 1999).
Sequence analysis of the UBC1651626 cloned fragment: The UBC1651626 sequence was subjected to BLASTN and BLASTX searches of the non-redundant GenBank Database. The BLASTN search produced a near-identical (0.0) match of UBC1651626 nucleotides 610 through 1615 to the Triticum aestivum, Ty1 copia-like retrotransposon Tar1 (Matsuoka and Tsunewaki 1997). The BLASTX search produced a similar result, with the predicted amino acid structure of UBC1651626 nucleotides 1103-1621 matching another copia-like retrotransposon, Oryza australiensis RIRE1 (1e-78) (Noma et al. 1997). Nucleotides 0-500 produced no significant hits from either BLASTN or BLASTX searches. Results of the sequence-similarity searches may explain, in retrospect, why polymorphic fragments were unobtainable among primer combinations that originated on the 3’ side of the UBC1651626 sequence (Figure 3). Retrotransposons are present in extraordinarily high copy numbers in the barley genome, making it difficult to develop discrete STS primer within them.
Summary: The goal of this research was to identify markers tightly linked to the Mla powdery mildew, resistance-gene cluster. Pools that were homogeneous for the (Mla6 + Mla14) or the (Mla13 + Ml-Ru3) resistance specificities were screened using RAPDs and bulked segregant analysis. Eleven markers linked to the Mla locus were identified. Three of these were identified from the primary RAPD screen and 8 STS markers were subsequently developed from the UBC-1651626 sequence. All 8 mapped 0.28 cM distal to the Mla cluster and the FR1062 primer pairs P0 and P1034RC proved useful in identifying large-insert YAC clones tightly linked to Mla from the barley cultivars Ingrid (Büschges et al. 1997) and Franka (Kleine et al. 1993; 1997).
Further research in our laboratory has provided additional AFLP-derived markers between Fr1062 and the Mla cluster (Wei et al. 1999). Eleven YACs were identified utilizing the STS primers from Fr1062, FW108 (AFLP-derived) and the tightly linked, resistance gene analog, Hv.b6 (Leister et al. 1997). The Fr1062 STS primers identified five of these YACs. Low-copy end clones isolated from these YACs were used further as probes to isolate a contig of BAC clones that spans the Mla resistance gene cluster (Wei et al. 1999).
References
Büschges, R., K. Hollricher, R. Panstruga, G. Simons, M. Wolter, A. Frijters, R. van Daelen, J. Groenendijk, S. Topsch, P. Vos, F. Salamini and P. Schulze-Lefert (1997) The barley Mlo gene: a novel control element of plant pathogen resistance. Cell 88: 695-705.
Bush, A. L., R. P. Wise, P. J. Rayapati, and M. Lee (1994) Restriction fragment length polymorphisms linked to genes for resistance to crown rust (Puccinia coronata) in near-isogenic lines of hexaploid oat (Avena sativa). Genome 37: 823-831.
DeScenzo, R. A., R. P. Wise, and M. Mahadevappa (1994) High resolution mapping of the Hor1/Mla/Hor2 region on chromosome 5S in barley. Molecular Plant-Microbe Interactions 7: 657-665.
Giovannoni, J. J., R. A. Wing, M. W. Ganal, and S. D. Tanksley (1991) Isolation of molecular markers from specific chromosomal intervals using DNA pools from existing mapping populations. Nucleic Acid Research 19: 6553-6558.
Jørgensen, J. H. (1994) Genetics of powdery mildew resistance in barley. Critical Reviews in Plant Sciences 13: 97-119.
Kintzios, S., A. Jahoor, and G. Fischbeck (1995) Powdery-mildew-resistance genes Mla29 and Mla32 in H. spontaneum derived winter-barley lines. Plant Breeding 114: 265-266.
Klein-Lankhorst, R. M., A. Vermont, R. Weide, T. Liharska, and P. Zabel (1991) Isolation of molecular markers for tomato (L. esculentum) using random amplified polymorphic DNA (RAPD). Theor. Appl. Genet. 83: 108-114.
Kleine, M., W. Michalek, A. Graner, R. G. Herrmann, and C. Jung (1993) Construction of barley (Hordeum vulgare L.) YAC library and isolation of a Hor1-specific clone. Mol. Gen. Genet. 240: 265-272.
Kleine, M., W. Michalek, T. Diefenthal, H. Dargatz, and C. Jung (1997) Construction of a MluI-YAC library from barley (Hordeum vulgare L.) and analysis of YAC insert terminal regions. Genome 40:896-902.
Kleinhofs, A., A. Kilian, M. A. S. Maroof, R. M. Biyashev, P. Hayes, F. Q. Chen, N. Lapitan, A. Fenwick, T. K. Blake, Kanazin, E. Ananiev, L. Dahleen, D. Kudrna, J. Bollinger, S. J. Knapp, B. Liu, M. Sorrells, M. Heun, J. D. Franckowiak, and D. Hoffman (1993) A molecular, isozyme, and, morphological map of the barley (Hordeum vulgare) genome. Theor. Appl. Genet. 86: 705-712.
Lander, E., P. Green, J. Abrahamson, A. Barlow, M.J. Daly, S.E. Lincoln, and L.Newman (1987) MAPMAKER: An Interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics. 1:174-181.
Leister, D., J. Kurth, D. A. Laurie, M. Yano, T. Sasaki, K. Devos, A. Graner, and P. Schulze-Lefert (1997) Rapid reorganization of resistance gene homologues in cereal genomes. Proc. Natl. Acad. Sci. USA. 95: 370-375.
Mahadevappa, M., R. A. DeScenzo, and R. P. Wise (1994) Recombination of alleles conferring specific resistance to powdery mildew at the Mla locus in barley. Genome 37: 460-468.
Matsuoka, Y. and K. Tsunewaki (1997) Presence of wheat retrotransposons in Gramineae species and the origin of wheat retrotransposon families. Genes Genet. Syst. 72: 335-343.
Mgonja, M. A., L. S. Dahleen, and J. D. Franckowiak (1995) Subsets from mapping populations for localization of new genes in barley. BGN. 24: 14-23. http://wheat.pw.usda.gov/ggpages/bgn/24/v24p14.html
Michelmore, R. W., I. Paran, and R. Kesseli (1991) Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segreganting populations. Proc. Natl. Acad. Sci. USA. 88: 9828-9832.
Noma, K., R. Nakajima, H. Ohtsubo, and E. Ohtsubo (1997) RIRE1, a retrotransposon from wild rice Oryza australiensis. Genes Genet. Syst. 72: 131-140.
Penner, G. A., J. Chong, M. Lévesque-Lemay, S. J. Molnar, and G. Fedak (1993) Identification of a RAPD marker linked to the oat stem rust gene Pg3. Theor. Appl. Genet. 85: 702-705.
Sambrook, J., E.F. Fritsch, and T. Maniatis (1989) Molecular cloning : a laboratory manual. 2nd ed. Cold Spring Harbor Laboratory, 3 v. Cold Spring Harbor, N.Y.
Schachermayr, G., H. Siedler, M. D. Gale, H. Winzeler, M. Winzeler, and B. Keller (1994) Identification and localization of molecular markers linked to the Lr9 leaf rust resistance gene of wheat. Theor. Appl. Genet. 88: 110-115.
Wei, F., K. Gobelman-Werner, S. M. Morroll, J. Kurth, L. Mao, R. Wing, D. Leister, P. Schulze-Lefert, and R. P. Wise (1999) The Mla (powdery mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. Genetics 153: 1929-1948.
Williams, J. G. K., A. R. Kubelik, K. J. Livak, J. A. Rafalski, and S. V. Tingley (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18: 6531-6535.
Williamson, V. M., J.-Y. Ho, F. F. Wu, N. Miller, and I. Kaloshian (1994) A PCR-based marker tightly linked to the nematode resistance gene, Mi, in tomato. Theor. Appl. Genet. 87: 757-763.
Wise, R. P., and A. H. Ellingboe (1983) Infection kinetics of Erysiphe graminis f. sp. hordei on barley with different alleles at the Ml-a locus. Phytopathology 73: 1220-1222.
Wise, R. P. and P. S. Schnable (1994) Mapping complementary genes in maize: positioning the rf1 and rf2 nuclear-fertility restorer loci of Texas (T) cytoplasm relative to RFLP and visible markers. Theor. Appl. Genet. 88: 785-795.
Yu Y., J. P. Tomkins, R. Waugh, D. A. Frisch, D. Kudrna, A. Kleinhofs, R. S. Brueggeman, G. J. Muehlbauer, R. P. Wise,·and R. A. Wing (2000) A bacterial artificial chromosome library for barley (Hordeum vulgare L.) and the identification of clones containing putative resistance genes. Theor. Appl. Genet. (in press).
Table 1. Oligonucleotide primers derived from the UBC1651626 sequence
|
Primer abbreviation |
Sequence 5' to 3' |
Sequence length |
ISU DSSF designationb |
|
P0a |
GAAGGCACTGAATCGTTGATGG |
22 |
KW0511 |
|
P53 |
CTTTGTATTGCTTTGCTATCTG |
22 |
KW0508 |
|
P174 |
TCGGTTTGGCTTTTTTCCTAATCC |
24 |
KW0513 |
|
P174RC |
GGATTAGGAAAAAAGCCAACCGA |
24 |
KW0084 |
|
P203 |
GTACAAGGGAAACGTGATTA |
20 |
KW1349 |
|
P203RC |
TAATCACGTTTCCCTTGTAC |
20 |
KW0509 |
|
P260RC |
GGGAATGAGCCGAGCCGAAC |
20 |
KW0507 |
|
P300 |
ACGAGGCGGGCGGTGGAGGAGGAG |
24 |
KW1816 |
|
P300RC |
CTCCTCCTCCACCGCCCGCCTCGT |
24 |
KW0510 |
|
P451 |
CAATGGTGGTGTGGACTCTAGG |
22 |
KW1817 |
|
P544 |
ACCATATACTAGAGGCAACACAAA |
24 |
KW0900 |
|
P544RC |
TTTGTGTTGCCTCTAGTATATGGT |
24 |
KW0901 |
|
P671 |
TGAACAGTGGACTAGGCCTTGAAC |
24 |
KW0902 |
|
P671RC |
GTTCAAGGCCTAGTCCACTGTTCA |
24 |
KW0903 |
|
P954 |
CAGTTTAGGGAAGTATTGCATC |
22 |
KW0097 |
|
P954RC |
GATGCAATACTTCCCTAAACTG |
22 |
KW0512 |
|
P1034 |
GTCTTCCACATCTAATCACGGG |
22 |
KW1362 |
|
P1034RC |
CCCGTGATTAGATGTGGAAGAC |
22 |
KW0086 |
|
P1373RC |
GATTGGCTTCGCCGGCTCTTGAG |
23 |
KW1361 |
|
P1585RC |
TGGAATTCACTATACTGGACAC |
22 |
KW1814 |
a
Primers shown in bold amplify the Fr1062 fragment.b
Designation given by the Iowa State University DNA Sequencing and SynthesisFacility (DSSF).