Altered Sites II in vitro mutagenesis system
dsDNA template 0.05 pmol (apx. 0.2 µg) 2M NaOH, 2mM EDTA 2.0 µl sdH2O to 20.0 µl final volume
note: ng of dsDNA = 0.032 x b, where b is the number of basepairs in the DNA.
The following reactions use both the antibiotic repair and knockout oligonucleotides. It is not necessary to include the knockout oligonucleotide if a second round of mutagenesis is not desired.
i. experimental mutagenesis reaction:
alkaline-denatured mutagenesis target clone 0.05 pmol chloramphenicol repair oligo, phosphorylated (0.25 pmol, 5:1 oligo:template) 1.0 µl tetracycline knockout oligo (0.25 pmol, 5:1 oligo:template) 1.0 µl mutagenic oligo, phosphorylated (25:1 oligo:template) 1.25 pmol 10X annealing buffer 2.0 µl sdH2O to 20.0 µl final volumeii. control mutagenesis reaction:
alkaline denatured pALTER-Ex2 DNA 0.05 pmol chloramphenicol repair oligo (2.2ng/ml) (0.25 pmol, 5:1 oligo:template) 1.0 µl tetracycline knockout oligo (2.2ng/ml) (1.25 pmol, 25:1 oligo:template) 5.0 µl 10X annealing buffer 2.0 µl sdH2O to 20.0 µl final volume
10X synthesis buffer 3.0 µl T4 DNA polymerase 1.0 µl (10 U) T4 DNA ligase 1.0 µl (2 U) sdH2O 5.0 µl Final volume will be 30.0 µl
It is convenient to prepare this media and its salts separately in one-half final volume. Each component is sterilized separately, and combined after cooling, along with a filter-sterilized carbon source and any nutritional requirements or antibiotics. The recipe below is used to make a final volume (after combination) of 100 ml, sufficient for approximately 4 plates. The salts can also be diluted to 1x with sdH2O and, affter addition of appropriate supplements and a carbon source, used as a broth for cultures.
M9 salts (2x) Minimal agarose (2x) Na2HPO4.7 H2O 0.60 g agarose 1.50 g KH2PO4 0.30 g sdH2O to 49.00 ml NaCl 0.05 g NH4Cl 0.10 g sdH2O to 50.00 mlAutoclave the M9 salts and minimal agar at 121°C, 15 lbs/in2 for 15 minutes. Store at room temperature. When ready to use, melt the 2x agarose and cool to 50°C or lower. Add to the 2x M9 salts 1 ml of a filter-sterilized 20% solution of glucose or other carbon source and any nutritional or antibiotic supplements, and warm the solution to 50°C in a water bath. Combine with the agarose solution, swirl to mix thoroughly.
For use with the Altered Sites mutagenesis kit for maintenance of E. coli JM109, Promega recommends the following additions to the M9 media:
MgSO4 (1 M) 200.0 µl (2.46 g/ml MgSO4·7 H2O, filter sterilize) CaCl2 (1 M) 10.0 µl (0.27 g/ml CaCl2·6 H2O or 0.15 g/ml CaCl2·2 H2O, filter sterilize) thiamine-HCl (1 M) 100.0 µl (0.34 g/ml, filter sterilize)Naladixic acid (50 g/ml final concentration from a 10 mg/ml sodium salt stock in dH2O or in 0.1 N NaOH to convert to the sodium salt, filter sterilize) may also be added to select for E. coli JM109, which is resistant due to the gyrA96 mutation carried by this strain.
Ammonium acetate, 7.5 M, pH 7.5
Dissolve 57.8 g ammonium acetate in approximately 50 ml dH2O. Adjust pH to 7.5 with ammonium hydroxide. Adjust to final volume of 100 ml, autoclave.
Ammonium acetate, 2 M, pH 4.6
Dissolve 15.4 g ammonium acetate in approximately 30 ml dH2O. Adjust pH to 4.6 with acetic acid. Adjust to final volume of 100 ml, autoclave.
10x TE buffer
Tris-Cl 1.58 g EDTA 0.37 gDissolve reagents in 70 ml dH2O. Adjust pH to 8.0 with HCl, bring to final volume of 100 ml, autoclave. Dilute 1:10 before use.
Table 1. Amount of mutagenic oligonucleotide equaling 1.25 pmol.
Oligo Amount
length equal to
1.25 pmol
17-mer 7.0 ng
20-mer 8.3 ng
23-mer 9.5 ng
26-mer 10.8 ng
29-mer 12.0 ng
note: ng oligo = 0.41 x no. of bases in oligo
Ampicillin repair oligonucleotide, phosphorylated
5'-d(pGTTGCCATTGCTGCAGGCATCGTGGTG)-3' (27-mer)Ampicillin knockout oligonucleotide, phosphorylated
5'-d(pGTTGCCATTGCGGCATCGTGGTGTCAC)-3' (27-mer)Tetracycline repair oligonucleotide, phosphorylated
5'-d(pGCCGGGCCTCTTGCGGGATATCGTCCA)-3' (27-mer)Tetracycline knockout oligonucleotide, phosphorylated
5'-d(pGCCGGGCCTCTTGCGGGCGTCCATTCC)-3' (27-mer)Chloramphenicol repair oligonucleotide, phosphorylated
5'-d(pCATTGCCATACGGAGTTCCGGATGAGC)-3' (27-mer)Chloramphenicol knockout oligonucleotide, phosphorylated
5'-d(pCATTGCCATACGGAACCGGATGAGC)-3' (25-mer)
Gel electrophoresis data
The following DNA species run at the indicated sizes on a 1% TAE gel:
M13KO7 helper phage 8.7 kb R408 helper phage 6.4 kb pALTER (ssDNA) 5.6 kb pALTER-Ex1 or -Ex2 (ssDNA) 5.8 kb
E. coli JM109 recA1 supE44 endA1 hsdR17 (rk-, mk+) gyrA96 relA1 thi (lac-proAB) F'[traD36 proAB+ lacIq lacZM15]
JM109 is useful for the production of single-stranded DNA from M13 or phagemid vectors. This strain is recA- and lacks the E. coli K restriction system, thus its usefulness as a recipient of cloned DNA is improved. The lack of endonuclease A1 leads to improved yield and quality of plasmid DNA. JM109 should always be maintained on minimal (M9) plates supplemented with 1mM thiamine-HCl to select for the presence of the F' episome; this element carries the proAB genes, required for proline synthesis. Maintenance of the F' episome is important for -complementation, ssDNA yields, and efficient transformation. JM109 is resistant to nalidixic acid due to the presence of the gyrA96 mutation and is auxotrophic for thiamine. The supE44 mutation causes the insertion of glutamine at amber (UAG) codons, and the traD36 mutation suppresses conjugal transfer of F factors. Both mutations are remnants of old NIH guidelines.
E. coli ES1301 mutS lacZ53 mutS201::Tn5 (Kmr) thyA36 rha-5 metB1 deoC IN(rrnD-rrnE)
ES1301 mutS is a mismatch repair minus E. coli strain. The mutation in mutS prevents mismatch repair of newly synthesized unmethylated DNA, leading to higher mutation efficiencies. This strain is recA+, thus inserts containing highly repetitive sequences may be unstable. ES1301 is kanamycin resistant due to the presence of Tn5 and is auxotrophic for methionine.
Back to the Channing Home Page.
Back to the Table of Contents.