GrainGenes

Name and affiliation

Email Address (required)

Please edit the entry directly and add any comments to the Comments box.
If you can supply a reference, we can reconcile your information with the original data source.
Additional information on the fields available in this data class can be found at the bottom of this page.
GrainGenes Sequence Report: BS00077633_51 Query'(optional)''in'Class' Sequence 'GrainGenes Sequence Report: BS00077633_51[Submit comment/correction] td,th {vertical-align:top; padding:0} Sequence BS00077633_51 Contig 4AS_5960827 Species Triticum aestivum Probe BS00077633_51 DNA ggctagctttattaaaattaaacaatgtttacatcgtctatgagcttacg Racaacacaaacacagtcaaaaggctcatccaaccaactgaaaaaagatt t BLAST BLAST Search GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.

Comments