Query (optional)   in Class  

GrainGenes Locus Report: k00002

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00002  [ Marker Report ]
Type
SNP
Chromosome
4H
Map
Hv-HNxH602-4H34.3
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak11d04
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = T/-
SNP structure (UNICODE) = AGTCAAGGCTT/-GCCGAGGATT
Parent 1 SNP sequence = AGTCAAGGCTTGCCGAGGATT
Parent 2 SNP sequence = AGTCAAGGCT-GCCGAGGATT