Query (optional)   in Class  

GrainGenes Locus Report: k00014

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00014  [ Marker Report ]
Type
SNP
Chromosome
7H
Map
Hv-HNxH602-7H146.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak11d12
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
SNP structure (UNICODE) = AGAGTTTTACRAGATACCCAT
Parent 1 SNP sequence = AGAGTTTTACGAGATACCCAT
Parent 2 SNP sequence = AGAGTTTTACAAGATACCCAT