Query (optional)   in Class  

GrainGenes Marker Report: SCM5

[ Printable Version ]  [ Submit comment/correction ]

Probe
SCM5
Locus
Xscm5
Xscm5-3R
Reference
ReferenceSaal B and Wricke G (1999) Development of simple sequence repeat markers in rye (Secale cereale L.) Genome 42:964-972.
Remarks
Contains repeat (GA)16
Primer pairs for microsatellite markers are available for academic use. Requests should be addressed to http://www.bafz.de/primer/start/php4
Type
PCR
SSR
PCR primers
5' TCGCGATACATCAAGATCGTG
3' CTAGCATCGACGTAACCCTTT
SSR size
285
Amplification Conditions
Annealing temperature = 50 degrees C
Source Species
Secale cereale



Locus for Probe
Xscm5
Type
Microsatellite
Chromosome
3R
Chromosome Arm
3RL
Map
Secale-PxP-update-3R92
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, update
Probe
SCM5



Locus for Probe
Xscm5-3R
Type
Microsatellite
Chromosome
3R
Map
Secale-PxP-2004-3R88.3
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, 2004
Species
Secale cereale
Probe
SCM5
Reference
ReferenceKhlestkina EK et al. (2004) Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags Theoretical and Applied Genetics 109:725-732.